Menoufia Medical Journal

ORIGINAL ARTICLE
Year
: 2016  |  Volume : 29  |  Issue : 4  |  Page : 921--928

Evaluation of the role of microRNA-21 in regulating the expression of PTEN (Phosphatase and Tensin Homolog) in egyptian hepatocellular carcinoma patients


Hisham A Ismail1, Hala H ElSaid2, Mostafa A Sakr1, Waleed F Alnoanmany2,  
1 Department of Molecular Diagnostics, Genetic Engineering and Biotechnology Research Institute, Sadat City University, Menoufiya, Egypt
2 Department of clinical Biochemistry, National Liver Institute, Menoufiya University, Menoufiya, Egypt

Correspondence Address:
Waleed F Alnoanmany
11 Youssif St., Shebin Elkom, El-Menoufiya, 32511
Egypt

Abstract

Objective The aim of this study was to evaluate the role of microRNA-21 and Phosphatase and Tensin Homolog (PTEN) in hepatocellular carcinoma (HCC). Background MicroRNAs are conserved, small (20–25) nucleotides, noncoding RNAs that negatively regulate the expression of mRNAs at the post-transcriptional level. MicroRNA signature is altered in different disease states, including cancer, and some microRNAs act as oncogenes or tumor suppressors. Materials and methods To identify the causal role of microRNA-21/PTEN in HCC, 30 newly diagnosed HCC cases of different stages, 20 hepatitis C virus-positive cases, and 20 healthy controls were tested for circulating microRNA-21 and the tumor suppressor gene PTEN using whole blood at the National Liver Institute, Menoufiya University. RNA and microRNA extraction, amplification, and real-time PCR were performed on all samples along with various other biochemical analyses. Results Real-time PCR analysis demonstrated upregulation of oncogenic microRNA-21 and showed reduced expression of the tumor suppressor gene PTEN at different stages of HCC. However, there were no significant microRNA-21 and PTEN changes in the hepatitis C virus or control groups. Receiver operating characteristic curve study showed that the best cutoff value for microRNA-21 was 3.93 (fold expression) with a sensitivity of 93% and specificity of 90%. The cut-off value for Alpha feto protein was 91.7 (ng/ml), with a sensitivity of 75.2% and specificity of 92.3%. Conclusion Increased expression of microRNA-21 could contribute to HCC growth and spread by affecting PTEN expression.



How to cite this article:
Ismail HA, ElSaid HH, Sakr MA, Alnoanmany WF. Evaluation of the role of microRNA-21 in regulating the expression of PTEN (Phosphatase and Tensin Homolog) in egyptian hepatocellular carcinoma patients.Menoufia Med J 2016;29:921-928


How to cite this URL:
Ismail HA, ElSaid HH, Sakr MA, Alnoanmany WF. Evaluation of the role of microRNA-21 in regulating the expression of PTEN (Phosphatase and Tensin Homolog) in egyptian hepatocellular carcinoma patients. Menoufia Med J [serial online] 2016 [cited 2020 Apr 5 ];29:921-928
Available from: http://www.mmj.eg.net/text.asp?2016/29/4/921/202517


Full Text

 Introduction



Hepatocellular carcinoma (HCC) is the fourth most common cancer in the world and the third most common cause of death related to cancer [1].

Chronic liver diseases caused by hepatitis C virus (HCV) are an established significant risk factor for the development of HCC, and HCV-related cirrhosis is the primary reason for the drastic increase in HCC [2]. In Egypt, according to the National Cancer Institute, the incidence rate of HCC has increased sharply in the last decade [3] and HCC was reported to account for about 4.7% of chronic liver disease patients [4].

In another study, in 2005, a remarkable increase from 7 to 14% was reported over a decade. Patients with advanced liver disease, particularly cirrhosis, are those at risk for HCC and should be screened every 6 months for its development [5]. An emerging area of HCC therapeutics is based on microRNAs [6]. MicroRNAs are small (˜21–23 nucleotides long), noncoding RNAs that regulate post-transcriptional gene expression of their target genes either by inducing translational repression through their binding to partially complementary sequences or by directing mRNA degradation through their binding to perfectly complementary sequences in the 3' untranslated region of messenger RNAs (mRNAs) [7].

Each mature microRNA potentially controls many gene targets, and each mRNA is regulated by multiple microRNAs. To date, more than 17 000 distinct mature microRNA sequences have been identified from over 140 species [8]. A number of recent studies have documented the involvement of microRNAs in HCC in tumor progression and metastasis [9].

In humans, more than 50% of microRNA genes are located at fragile sites or in cancer-associated genomic regions that are frequently involved in chromosomal abnormalities, such as loss of heterozygosity, amplification, and breakpoints [10], indicating that they might be useful as novel diagnostic and/or prognostic markers and could constitute potential molecular targets in cancers.

Thus, microRNAs modulate various cellular signaling pathways involved in cell growth, proliferation, motility, and survival. MicroRNAs are also subjected to regulation by epigenetic mechanisms, and mutations in their promoter and coding regions were shown to contribute to tumorigenesis [11].

Phosphatase and Tensin Homolog (PTEN) is a ubiquitous tumor suppressor gene, and the functional inactivation of PTEN by regulation of its expression is relevant to many solid tumors [12]. Observations indicating that PTEN can reverse many of the biological effects of microRNA-21 implicate it as a predominant target of microRNA-21 in these processes [13]. PTEN has been implicated as a key contributor to HCC pathogenesis and growth [14]. Although mutation of PTEN is an infrequent event, PTEN protein expression is frequently decreased or absent in human HCC cases [15]. Moreover, decreased PTEN correlates with tumor progression and poor prognosis in HCC [16].

 Aim of the Work



The aim of the study was to evaluate the role of microRNA-21 in regulating the expression of PTEN and its effect in HCC.

 Materials and Methods



Study design

The study was conducted on 70 patients who were divided into three groups. They were selected from inpatient wards and the outpatient clinic of the National Liver Institute, Menoufiya University, from January 2014 to September 2014. The ethical committee of the National Liver Institute approved the study protocol, and enrollment of the individuals was conditioned by written informed consent.

The patients were grouped as follows:

Group 1 (HCC group): This group included 30 newly diagnosed patients (26 men and four women) who had not received therapy. Their ages ranged from 35 to 51 years. The diagnosis was based on clinical examination, laboratory tests, ultrasonography, and spiral computed tomography, as well as liver biopsy in some cases.

Group 2 (chronic viral hepatitis C: the HCV group): This group included 20 patients (15 men and five women) with HCV. Their ages ranged from 30 to 52 years. They were diagnosed by ultrasonographical findings (shrunken liver, coarse echopattern, attenuated hepatic vein, and fine nodular surface), PCR, and biochemical evidence of parenchymal damage as well as liver biopsy in some cases.

Group 3 (the control group): This group included 20 apparently healthy subjects (18 men and two women) who served as controls. Their ages ranged from 32 to 53 years.

All patients and controls were subjected to the following:

Biochemical tests such as those for liver function, prothrombin concentration (PC%), viral markers, serum AFP, complete blood count, and kidney functions.

Quantification of microRNA-21 and its housekeeping gene (RNU43) and of PTEN and its housekeeping gene (GAPDH) using real-time PCR technology (7500 Fast Real Time PCR – TaqMan microRNA and RNA Control Assay; Applied Biosystems, NY, USA).

Extraction

For the real-time PCR, MirRNAs were extracted (miRNA extraction kit; Qiagen, Hilden, Germany) from whole blood on EDTA using QIAzol (lysis solution) according to the manufacturer's instruction.

Step 1: extraction of miRNA

Whole blood sample of 0.2 ml was placed in a 1.5 ml RNase-free microcentrifuge tubeLysis solution (Qiazol) of 0.2 ml was addedThorough vortexing to disrupt and lyse the blood cells was done, and the lysate was incubatedfor 5 min at room temperatureChloroform of 200 µl was added. Vortexing for ½ min was done until the mixture turned white in colour and it was incubatedfor 4 min at room temperatureThe mixture was then cooled in a centrifuge for 14 min at 14000 rpm. Three layers were produced (a colorless layer, a nonvisible layer, and a pink layer)The colorless layer (about 600 µl) was taken in an Eppendorf tube and 900 µl of ethanol was added, followed by vortexingThe sample was transferred to a spin cartridge (with a collection tube). Centrifugation was performed at 10 000 rpmfor 15 s at room temperature and the flow-through discardedWash buffer RWT of 700 μl was added to the spin cartridge. This was followed by centrifuging at 10 000 rpmfor 15 s at room temperature. The flow-through and the collection tube were discarded and the spin cartridge was placed in a new collection tubeWash buffer Rbe of 500 μl with ethanol was added to the spin cartridgeCentrifugation was performed at 10 000 rpmfor 15 s at room temperature. The flow-through was discarded and the spin cartridge was reinserted in the same collection tubeCentrifugation was performed again for 2 min to eliminate any traces of ethanolThe collection tube was discarded and the spin cartridge was inserted into a recovery tubeRNase-free water of 50 μl was added to the center of the spin cartridgeThe mixture was incubated at room temperature for 1 minThe spin cartridge and recovery tube were centrifuged for 2 min at 10 000 rpmat room temperaturePurified miRNA was then converted to cDNA.

Single-stranded cDNAs were generated using the RT kit (TaqMan Reverse Transcriptase kit) according to the manufacturer's directions.

[INLINE:1]

RNA For the real-time PCR was extracted (Purelink RNA kit) from whole blood on EDTA using LIAzol (lysis solution) as per the manufacturer's instructions.

Steps of the procedure according to the manufacturer's protocol

A fresh amount of lysis buffer containing 1% 2-mercaptoethanol for each purification procedure was prepared by adding 2 μl 2-mercaptoethanol to 0.2 ml lysis bufferA volume of 60 ml of 96–100% ethanol was added directly to the bottle of the wash buffer II. The label on the bottle was checked to indicate that ethanol had been added and it was stored at room temperatureThe following protocol was followed to purify total RNA from 0.2 ml of fresh whole blood:A volume of 0.2 ml or less of whole blood sample was placed in a 1.5 ml RNase-free microcentrifuge tubeLysis buffer of 0.2 ml was prepared, with 2-mercaptoethanol addedThe mixture was thoroughly vortexed to disrupt and lyse the blood cells. The lysate was centrifuged at 12 000g for 2 min at room temperatureThe supernatant was transferred to a clean 1.5 ml RNase-free microcentrifuge tubeA volume of 200 μl of 100% ethanol was added to the microcentrifuge tube. Any precipitate was dispersed by vortexing or by pipetting up and down several times (using RNase-free pipette tips)The sample (including any remaining precipitate) was transferred to the spin cartridge (with a collection tube) and centrifuged at 12 000 g for 15 s at room temperature. The flow-through was discarded.A volume of 700 μl of wash buffer I was added to the spin cartridge and centrifugation was performed at 12 000 g for 15 s at room temperature. The flow-through and the collection tube were discarded and the spin cartridge was placed into a new collection tubeA volume of 500 μl of wash buffer II with ethanol was added to the spin cartridgeCentrifugation was performed at 12 000 g for 15 s at room temperature. The flow-through was discarded and the spin cartridge was reinserted in the same collection tubeSteps (h–i) were repeated onceThe spin cartridge was centrifuged at 12 000 g for 1 min at room temperature to dry the membrane with attached RNA. The collection tube was discarded and the spin cartridge was inserted into a recovery tubeRNase-free water of 30 μl–3 × 100 μl was added to the center of the spin cartridgeThe mixture was incubated at room temperature for 1 minThe spin cartridge and recovery tube were centrifuged for 2 min for at least 12 000 g at room temperatureThe purified RNA was used to analyze the RNA yield and quality, and total RNA was quantified using Nanodrop, Applied biosystems, NY, USA 1000 (Nanodrop).

Single-stranded cDNAs were generated using the RT kit (high capacity cDNA reverse transcription kit) according to the manufacturer's directions.

[INLINE:2]

Quantification

PCR quantification experiments were performed with PCR (Real Time 7500 Fast PCR system; Applied Biosystems) using the TaqMan miRNA assay (MiRNA-21), gene expression TaqMan assay (PTEN), and universal TaqMan master mix according to the manufacturers' protocol.

Detection of mRNA levels by RT-PCR

[INLINE:3]

Detection of miRNA-21 levels by RT-PCR

[INLINE:4]

The primers for microRNA-21 were as follows: forward primer AGAAATGCCTGGGTTTTTTTGGTT and reverse primer TTGGGAATGCTTTTCAA AGAAGGT.

The primers for PTEN were as follows: forward primer CTTTTAGTTGTGCTGA AAGACATTATGACA and reverse primer TCTCACTCGATAATCT.

GGATGACTCATT and housekeeping genes were supplied by Qiagen. Fluorescence measurements were taken at every cycle. The cycling conditions were as follows: holding stage at 95°C for 2 min, followed by 40 cycles each at 95°C for 10 s (denaturation) and at 60°C for 1 min (annealing and extension).

Expression was reported as ΔCt values, where

ΔCt = Ct (target)−Ct (reference).

Mean control = (Ctrl1 + Ctrl2 + Ctrl3+…)/N.

ΔΔCt = ΔCt (target)−Ct (mean control).

Normalized target gene expression level (RQ) = 2(−ΔΔCt).

Δ = delta; CT = threshold cycle; RQ = relative quantification.

Statistical analysis

Data were collected, tabulated, and statistically analyzed by SPSS, version 24.0 (SPSS Inc., Chicago, Illinois, USA). Analysis of variance (followed by least significant difference post-hoc test), the Kruskal–Wallis test, Student's t-test, c2-test, and Spearman's rank correlation tests were performed at 5% level of significance. The diagnostic performance of microRNA-21 and PTEN in discriminating HCC cases from normal cases was evaluated using receiver operating characteristic curve analysis. The sensitivity, specificity, positive predictive value, and negative predictive value for each marker were determined.

 Results



[Table 1] shows that:{Table 1}

There was a statistically significant increase in the mean serum level of microRNA-21 RQ (fold expression) in the HCC group compared with the HCV and control groups (P < 0.01). Further, there was no significant elevation in the HCV group compared with the control group (P > 0.05)The mean PTEN RQ (fold expression) was significantly decreased in the HCC group compared with the HCV and control groups (P < 0.01). Further, there was no significant difference in the HCV group compared with controls (P > 0.05).

[Table 2] shows that:{Table 2}

There was a highly significant positive correlation between microRNA-21 and the size of the focal lesion in terms of diameter compared with PTEN, which showed an inverse correlation with focal lesion sizeThere was a highly significant inverse correlation between microRNA-21 and PTEN RQs (fold expression) in the HCC group (inversely related).

[Table 3] shows that:{Table 3}

In the HCC group, microRNA-21 showed a highly significant increase with focal lesion size of at least 3 cmPTEN decreased significantly with focal lesion size of at least 3 cmPTEN showed no significant changes in level with focal lesion size less than 3 cm.

[Table 4] shows Pearson's correlation matrix between microRNA-21, PTEN, and different tumor characteristics of HCC.{Table 4}

[Table 4] shows that tumor size, tumor stage, and vascular invasion had a significant positive correlation with the mean serum level of miRNA-21, but cirrhosis, size of the tumor, stage of the tumor, and vascular invasion had significant inverse correlation with the mean serum level of PTEN in the HCC group.

[Table 5] shows the validity of the cutoff value of the circulating microRNA-21 and plasma α-fetoprotein for the prediction of HCC.{Table 5}

[Table 5] shows that when we used microRNA-21 at a cutoff point of 3.93 (fold expression) for the diagnosis of HCC, sensitivity was 93% but specificity was 90%.

When we used AFP at a cutoff point of 91.7 (ng/ml) for the diagnosis of HCC, sensitivity was 75.2% but specificity was 92.3%. This potentiates the idea of their use as co-biomarkers for HCC.

 Discussion



Although a role for microRNAs in cancer has been proposed, the molecular mechanisms by which microRNA can modulate tumor growth or metastases are unknown [12]. Previous studies show that microRNA-21 expression is increased in malignant hepatocytes, and in human HCC compared with matching nontumoral tissue [13]. Moreover, microRNA-21 promotes cell invasion, migration, and growth through repression of PTEN expression and downstream effects involving the phosphorylation of focal adhesion kinase (FAK) and protein kinase B (Akt), and the expression of matrix metalloproteinases (MMP-2 and MMP-9) [14]. The identification of microRNA-21 as an important regulator of tumor cell proliferation, migration, and invasion in vitro emphasizes an essential role of this microRNA in mediating hepatic oncogenesis and tumor behavior, and provides insight into the contribution of altered microRNA expression in contributing to the tumor phenotype [15].

In this study, the results show that circulating microRNA-21 was significantly overexpressed in the blood of HCC patients compared with HCV patients and controls ([Table 1]), which shows a statistically significant increase in the mean serum level of microRNA-21 RQ (fold expression) in the HCC group compared with the HCV and control groups (P < 0.05). Further, there was no significant elevation in the HCV group compared with controls (P > 0.05). These results agreed with those of Esau et al. [13], who reported that microRNA-21 expression was increased in malignant hepatocytes and in human HCC compared with matching nontumoral tissue, and with those of Esquela-Kerscher and Slack [17], who reported that microRNA-21 was overexpressed in many different solid tumors, including breast, colon, lung, pancreas, prostate, and stomach, and in cholangiocarcinoma cell lines.

PTEN is a ubiquitous tumor suppressor gene and the functional inactivation of PTEN by regulation of its expression is related to many solid tumors. PTEN has been implicated as a key contributor to HCC pathogenesis and growth. Targeted deletion of PTEN in murine hepatocytes leads to the development of HCC [12]. Although mutation of PTEN is an infrequent event, PTEN protein expression is frequently decreased or absent in human HCC [18]. Moreover, decreased PTEN correlates with tumor progression and poor prognosis in HCC [19].

In the present study, the mean PTEN RQ (fold expression) was significantly decreased in the HCC group compared with the HCV and control groups (P < 0.01). Further there was no significant difference in the HCV group compared with the control group (P > 0.05). These results concurred with those of Krutzfeldt et al. [14], who reported that microRNA-21 promotes cell invasion, migration, and growth through repression of PTEN expression and downstream effects involving the phosphorylation of FAK and Akt, and the expression of MMP-2 and MMP-9, and with those of Hu et al. [19], who found that decreased PTEN correlates with tumor progression and poor prognosis in HCC.

Targeting microRNA-21 could modulate the expression of downstream mediators of tumor growth and metastasis. Therefore, therapeutic strategies to decrease microRNA-21 may be useful to limit HCC growth and metastasis. Further work is warranted to evaluate the role of microRNA-21 and the identified downstream targets and to develop therapeutic strategies targeting microRNA-21 in vivo. The ability to therapeutically manipulate microRNA-21 expression is feasible, and recent proof-of-concept studies have shown that microRNA-21 antagonists targeted to the liver can modulate the expression of downstream genes [13].

We discovered an important fact when performing the experiment on whole blood taken on EDTA. On assessing the circulating microRNA-21 level and PTEN expression in the studied groups (HCC, HCV, and control), the results and findings were approximately identical to those obtained for tissues by using various techniques. As this experiment was conducted in the National Liver Institute on Egyptian people, we cannot generalize the findings to other countries or circumstances. However, the accuracy of the obtained results could be very beneficial in avoiding invasive techniques like biopsies to obtain tissue samples.

[Table 2] reveals a highly significant inverse correlation between microRNA-21 and PTEN RQs (fold expression) in the HCC group (inversely related), which indicates that microRNA-21 upregulates HCC cells by repression of the tumor suppressor gene PTEN. This result concurred with that of Zhang et al. [20] and Meng et al. [21].

Another important result that can aid diagnosis is the relation of microRNA-21 and focal lesion size in HCC ([Table 3]). There was a highly significant correlation between microRNA-21, PTEN, and the largest focal lesion size. This result can be applied in the early diagnosis of HCC. This finding agreed with that of Liao et al. [22], who confirmed that as a potential diagnostic biomarker for HCC, circulating microRNA-21 possesses several unique advantages. First, serum or plasma microRNA is characterized by minimal invasion and convenience compared with histopathological examination. Second, serum microRNA expression levels are stable and reproducible [23] Third, plasma microRNA-21 level cannot be influenced by both cirrhosis and viral status. Fourth, significant overexpression of plasma microRNA-21 was observed even in patients with early-stage HCC [24]. On the other hand, AFP level of 400 ng/ml is considered an indicator of HCC in general, which does not occur at an early HCC stage. As a result, about one-third of all HCC cases with small lesions (<3 cm) were not diagnosed in the early tumor stage [25]. Therefore, circulating microRNA-21 may serve as a novel co-biomarker to AFP to improve the diagnostic accuracy of early-stage HCC [Figure 1].{Figure 1}

A receiver operating characteristic curve [Figure 2] and [Figure 3] was plotted for both microRNA-21 and AFP in HCC to compare sensitivities, specificities, and cutoffs. We found that the smallest cutoff point for the plasma α-fetoprotein as a predictor marker for HCC was 91.7 (ng/ml). The area under the curve was 0.83 (P < 0.01). Sensitivity was 75.2% but specificity was 92.3%. The smallest cutoff point for the circulating microRNA-21 as a predictor marker for HCC was 3.93 (fold expression). The area under the curve was 0.97 (P < 0.01). Sensitivity was 93% but specificity was 90%.{Figure 2}{Figure 3}

This proves that as a screening tool for HCC circulating microRNA-21 was more sensitive than AFP [25], and highly specific, almost the same as AFP.

Our findings potentiate the beneficial therapeutic implementation of microRNA inhibitors (small, double-stranded RNA molecules that regulate gene expression by binding to and inhibiting a specific mature microRNA). The microRNA inhibitors were designed with an appropriate algorithm and the mature microRNA sequence information from miRBase. The algorithm computes all possible sequence parameters and selects the one predicted to best maintain the TuD structure, providing maximum microRNA recognition and binding. Each synthetic TuD (S-TuD) is stabilized by incorporating 2'-O-methylated nucleotides, and provides two microRNA binding sites. Optimal microRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor that is based upon the synthetic 'Tough Decoy' (TuD) 2 molecules in various gene therapy cancer control programs, which gives promising results [26].

 Conclusion



Increased expression of microRNA-21 could contribute to HCC growth and spread by affecting PTEN expressionCirculating microRNA-21 level could be used as a biological marker for HCC and it might be beneficial in early diagnosisMicroRNA-21 and plasma AFP could be used as co-biomarkers for HCC diagnosis.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

References

1El-Serag HB, Davila JA. Surveillance for hepatocellular carcinoma: in whom and how?. Therap Adv Gastroenterol 2011; 4:5–10.
2El-Zayadi AR, Badran HM, Barakat EM, Attia M, Shawky S, Mohamed MK. Hepatocellular carcinoma in Egypt: a single center study over a decade. World J Gastroenterol 2005; 11:5193–5198.
3El-Said HH, GhanayemNM, Badr E, El-Fert AY, Ahmed K. Cytotoxic T-lymphocyte antigen-4 gene polymorphisms in hepatocellular carcinoma patients in Egypt. Menoufia Med J 2014; 27:372–378.
4Ikeda M, Fujiyama S, Tanaka M, Sata M, Ide T, Yatsuhashi H, Watanabe H. Risk factors for development of hepatocellular carcinoma in patients with chronic hepatitis C after sustained response to interferon. J Gastroenterol 2005; 40:148–156.
5Degos F, Christidis C, Ganne-Carrie N, Farmachidi JP, Degott C, Guettier C. Hepatitis C virus related cirrhosis (time to occurrence of hepatocellular carcinoma and death). Gut 2000; 47:131–136.
6Ebert MS, Sharp PA. Roles for microRNAs in conferring robustness to biological processes. Cell 2012; 149:515–524.
7Kozomara A, Griffiths-Jones S. miRBase. Integrating microRNA annotation and deep-sequencing data. Nucleic Acids Res 2011; 39:D152–D157.
8Negrini M, Gramantieri L, Sabbioni S, Croce CM. microRNA involvement in hepatocellular carcinoma. Anticancer Agents Med Chem 2008; 11:500–521.
9Law PT, Wong N. Emerging roles of microRNA in the intracellular signaling networks of hepatocellular carcinoma. J Gastroenterol Hepatol 2011; 26:437–439.
10Aravalli RN, Cressman EN, Steer CJ. Cellular and molecular mechanisms of hepatocellular carcinoma: an update. Arch Toxicol 2012; 87:227–247.
11Datta J, Kutay H, Nasser MW, Nuovo GJ, Wang B, Majumder S, et al. Methylation mediated silencing of MicroRNA-1 gene and its role in hepatocellular carcinogenesis. Cancer Res 2008; 68:5049–5058.
12Wan XW, Jiang M, Cao HF, He YQ, Liu SQ, Qiu XH, et al. The alteration of PTEN tumor suppressor expression and its association with the histopathological features of human primary hepatocellular carcinoma. J Cancer Res Clin Oncolology 2013; 129:100–106.
13Esau C, Davis S, Murray SF, Yu XX, Pandey SK, Pear M, et al. MiR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. Cell Metab 2009; 3:87–98.
14Krutzfeldt J, Rajewsky N, Braich R, Rajeev KG, Tuschl T, Mano- haran M, et al. Silencing of microRNAs in vivo with 'an-tagomirs'. Nature 2005; 438:685–689.
15Itoh S, Maeda T, Shimada M, Aishima S, Shirabe K, Tanaka S, et al. Role of expression of focal adhesion kinase in progression of hepatocellular carcinoma. Clin Cancer Res 2014; 10:2812–2817.
16Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, Visone R, et al. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci USA 2006; 103:2257–2261.
17Esquela-Kerscher A, Slack FJ. Oncomirs – microRNAs with a role in cancer. Nat Rev Cancer 2006; 6:259–269.
18Horie Y, Suzuki A, Kataoka E, Sasaki T, Hamada K, Sasaki J, et al. Hepatocyte-specific Pten deficiency results in steatohepatitis and hepatocellular carcinomas. J Clin Invest 2004; 113:1774–1783.
19Hu TH, Huang CC, Lin PR, Chang HW, Ger LP, Lin YW, et al. Expression and prognostic role of tumor suppressor gene PTEN/MMAC1/TEP1 in hepatocellular carcinoma. Cancer 2003; 97:1929–1940.
20Zhang JG, Wang JJ, Zhao F, Liu Q, Jiang K, Yang GH. MicroRNA-21 (miR-21) represses tumor suppressor PTEN and promotes growth and invasion in non-small cell lung cancer (NSCLC). Clin Chim Acta 2010; 41:846–852.
21Meng F, Henson R, Wehbe–Janek H, Ghoshal K, Jacob ST, Patel T. MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer. Gastroenterology 2007; 133:647–658.
22Liao Q, Han P, HuangY, Wu Z, Chen Q, Li S, et al. Potential role of circulating microRNA-21 for hepatocellular carcinoma diagnosis: a meta-analysis. PLoS One 2015; 10:e0130677.
23Chen X, Ba Y, Ma L, Cai X, Yin Y, Wang K, et al. Characterization of microRNAs in serum: a novel class of biomarkers for diagnosis of cancer and other diseases. Cell Res 2008; 18:997–1006.
24Tomimaru Y, Eguchi H, Nagano H, Wada H, Kobayashi S. Circulating microRNA-21 as a novel biomarker for hepatocellular carcinoma. J Hepatol 2012; 56:167–175.
25Corvallis AH. Early diagnosis of hepatocellular carcinoma by microRNAs: shining a light from the genome's 'dark matter'. Dig Dis Sci 2012; 57:2737–2739.
26Haraguchi T, Haruo N, Takanobu N, Tokimitsu O, Youshihito U, testsuo Y, et al. A potent 2'-O-methylated RNA-based microRNA inhibitor with unique secondary structures. Nucleic Acids Res 2012; 40:58–123.