Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2020  |  Volume : 33  |  Issue : 3  |  Page : 904-908

Association of type 1 collagen (COLIA1) gene polymorphism with osteoporosis in thalassemia major


1 Department of Clinical Pathology, Faculty of Medicine, Menoufia University, Menoufia, Egypt
2 Department of Clinical Pathology, Faculty of Medicine, Tanta University, Tanta, Egypt
3 Department of Pediatric Medicine, Faculty of Medicine, Menoufia University, Menoufia, Egypt

Date of Submission16-Oct-2018
Date of Decision22-Nov-2018
Date of Acceptance25-Nov-2018
Date of Web Publication30-Sep-2020

Correspondence Address:
Samya S. M. Mashal
Berket Alsabih, Menoufia
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/mmj.mmj_318_18

Rights and Permissions
  Abstract 


Objectives
The objective of this article is to study the association of COLIA1 gene polymorphism with osteoporosis in thalassemia major.
Background
Beta-thalassemia is a group of autosomal recessive hereditary hemoglobinopathy characterized by a deficiency or absence of B globin chain of adult hemoglobin. Osteoporosis is common sequelae in these patients. Several genes are involved in the development of osteoporosis such as collagen type I alpha 1, vitamin D receptors, estrogen receptors, and interleukin-6 which monitor bone mineral density and bone shape and structure. COLIA1 encodes the alpha 1 chain of collagen type I which is the most abundant structural protein in the bone matrix.
Patients and methods
Sixty patients with beta-thalassemia (29 women, 31 men) aged 4–15 years and 20 healthy participants were cross-matched with age and sex. Serum calcium, serum phosphorus, serum alkaline phosphatase, and dual-energy radiograph absorptiometry scan were examined in the studied groups. The COLIA1 gene polymorphism was measured by restriction fragment length polymorphism-PCR.
Results
The study indicated that the SS genotype in thalassemia is 48.3%, but higher in the control group (80%). The Ss genotype in thalassemia is 43.3% but lower in the control group (20%) and the ss genotype in thalassemia is 8.3 but in the control group is 0% (P = 0.042). The frequency of S alleles in thalassemia is 70% but in the control group is 90% and the frequency of s alleles in thalassemia is 30% but in the control group is 10% (P = 0.011).
Conclusion
Early detection of the SP1 binding site on the COLIA1 gene polymorphism among thalassemic patients could help in the management of these patients.

Keywords: beta-thalassemia, collagen, hemoglobinopathy, osteoporosis, polymorphism


How to cite this article:
Eledel RH, Abdelhamid AH, Ragab SM, Omar TA, Mashal SS. Association of type 1 collagen (COLIA1) gene polymorphism with osteoporosis in thalassemia major. Menoufia Med J 2020;33:904-8

How to cite this URL:
Eledel RH, Abdelhamid AH, Ragab SM, Omar TA, Mashal SS. Association of type 1 collagen (COLIA1) gene polymorphism with osteoporosis in thalassemia major. Menoufia Med J [serial online] 2020 [cited 2020 Oct 29];33:904-8. Available from: http://www.mmj.eg.net/text.asp?2020/33/3/904/296660




  Introduction Top


Thalassemia is a hereditary disease that causes imbalanced production of globin chains. This genetic deficiency leads to marked microcytic hypochromic anemia in thalassemia major [1]. This disorder causes inefficient erythropoiesis and bone marrow hyperplasia resulting in a decrease bone marrow density [2]. Osteoporosis is predicted by dual-energy radiograph absorptiometry (DEXA) scan with osteoporosis being diagnosed if the T-score is at or below −2.5. Osteopenia is diagnosed if the T-score is between −1 and −2.5 and no bone affection if the T-score is at −1.0 and above [3]. There are many mechanisms involved in the pathogenesis of bone abnormalities in thalassemia major such as impairments in osteoblast activity, abnormal osteoclast activity, hormonal factors, genetic factors, iron overload, and nutritional factors [4]. Several genes are involved in the development of osteoporosis such as collagen type I (alpha 1), vitamin D receptors, estrogen receptors, and interleukin-6 which monitor bone mineral density and bone shape and structure [5]. COLIA1 gene encodes the alpha 1 chain of collagen type I which is considered the main component of the bone matrix [6]. A polymorphism (GT) in the first intron of COLIA1 affects one of the binding sites of the transcription factor SP1 leading to a reduction of bone mineral density (BMD) and is predisposed to osteoporosis [7]. Alleles with a G base at the SP1 binding are defined as S while alleles with a T base are defined as s [8].

Aim of the study

To study the association of COLIA1 gene polymorphism with osteoporosis in thalassemia major.


  Patients and Methods Top


This study was done in the Clinical Pathology Department, Faculty of Medicine, Menoufia University Hospitals. This study was carried out between November 2017 and July 2018 on 100 participants who were divided into two groups. Group 1 includes 60 thalassemic patients classified according to DEXA scan to group 1a: 20 patients with osteoporosis, BMD is 2.5 SD or more or below that of a young normal adult (T-score at or below –2.5); group 1b: 20 patients with osteopenia, BMD is between 1.0 and 2.5 SD below that of a young normal adult (T-score between −1 and −2.5); group 1c: 20 patients with normal BMD, BMD is within 1 SD of a young normal adult (T-score at −1.0 and above). Group 2: this includes 20 age-matched and sex-matched healthy children as controls.

For all participants the following were done: written informed consents were provided by all participants and agreement was obtained from the ethics committee, complete history taking as onset of transfusion, frequency of transfusion and duration of iron chelator, anthropometric measurements, DEXA scan, complete blood count, High-performance liquid chromatography (HPLC), serum ferritin, serum calcium, phosphorus, and alkaline phosphatase.

Under complete aseptic conditions, 7 ml of venous blood was collected. Each blood sample was divided as follows. Tube A: 4 ml was collected in a plain tube. The serum was used to determine the level of calcium, phosphorus, alkaline phosphatase (AU 680 chemical analyzer; Beckman Coulter, Indianapolis, Indiana, USA) and the ferritin level (Hitachi Cobas e 411 High-Technologies Corporation, Tokyo, Japan). Tube B: 3 ml was collected in sterile vacutainer tubes containing EDTA for complete blood picture, High-performance liquid chromatography (HPLC), and DNA extraction.

DNA was extracted from leukocytes of peripheral blood samples using the QIAamp UltraSens virus extraction kit (Qiagen, Valencia, California, USA) according to the manufacturer's protocol. The extracted DNA was stored at −20°C till analysis [9].

The sequence of primers: forward primer (5′GTCCAGCCCTCATCCTGGCC -3′) and reverse primer (5′-TAACTTCTGGACTATTTGCGGACTTTT TGG -3′).

Reagents and primers were provided by Qiagen. PCR reaction with 25 μl final volume was prepared by adding 12.5 μl Master Mix, 1.25 μl forward primer, 1.25 μl reverse primer, 9 μl extracted DNA, and 1 μl sterile high--quality water into PCR wells.

The PCR was done by the following conditions: initial denaturation at 94°C for 3 min, 35 cycles (94°C for 50 s for denaturation, 62°C for 45 s for annealing, 72°C for 15 s for extension) and for final extension step 72°C for 5 min. The amplified products were digested with Bal 1, restriction enzyme (part No. R0534S, 250 units; BioLabs, New England Biolabs, UK).

A measure of 10 μl of the amplified product was added to 7 μl sterile distilled water followed by 1 μl of restriction enzyme and 2 μl of reaction buffer and then incubated at 37°C for 15–20 min.

Electrophoresis was done on the digested products: the homozygous variant SS (G/G) results in one fragment at 264 bp, homozygous variant ss (T/T) results in one fragment at 246 bp while the heterozygous variant Ss (G/T) results in two fragments at 264 bp and 246 bp.

Statistical analysis

The results were collected, tabulated, and statistically analyzed by an IBM compatible personal computer with SPSS statistical package version 23, (IBM corp, Armonk, NY, USA).

Two types of statistical analysis were done:

  1. Descriptive statistics, for example, was expressed in: number, percentage (%), mean, and SD
  2. Analytic statistics: Student's t test, Mann–Whitney's test, Kruskal–Wallis, χ2 test, Fischer's exact test, and Z test.



  Results Top


Lanes 1, 2, 5, and 9: represent the homozygous cases (SS) genotype of the collagen gene (G/G). Lane 3, 7: represent the heterozygous cases (Ss) genotype of the collagen gene (G/T). Lane 4, 6, 8: represent homozygous cases (ss) genotype of the collagen gene (T/T) [Figure 1].
Figure 1: A representation of collagen gene polymorphism by RFLP-PCR. RFLP, restriction fragment length polymorphism.

Click here to view


Group 1a are thalassemic patients with osteoporosis (seven men and 13 women), their ages were 10.35 ± 2.76 years, their weights were 34.40 ± 9.70 kg, and their heights were 133.35 ± 16.45 cm. Group 1b are thalassemic patients with osteopenia (nine men and 11 women), their ages were 9.30 ± 2.39 years, their weights were 29.0 ± 7.31 kg, and their heights were 126.95 ± 13.47 cm. Group 1c are thalassemic patients with normal DEXA scan (15 men and five women), their ages were 9.75 ± 2.71 years, their weights were 31.65 ± 10.86 kg, and their heights were 134.0 ± 14.59 cm. Group 2 are apparently healthy age-matched and sex-matched as a control group (nine men and 11 women), their ages were 9.5 ± 2.76 years, their weights were 31.80 ± 10.42 kg, and their heights were 135.45 ± 15.13 cm. There was a statistically significant difference in family history and DEXA scan between the studied groups (P < 0.001), while there was no statistically significant difference in the duration of iron chelator, frequency, and onset of transfusion between the studied groups [Table 1]. There was statistically significant difference in the laboratory findings (ferritin, hemoglobin, HbF, calcium, phosphorus, alkaline phosphatase) between the studied groups (P < 0.001) [Table 2]. There was statistically significant difference in COLIA1 gene distribution between thalassemic patients and controls, the SS genotype in thalassemia is 48.3% but higher in the control group (80%); the Ss genotype in thalassemia is 43.3 but lower in the control group (20%) and ss genotype in thalassemia is 8.3 but in the control group is 0%. The frequency of S alleles in thalassemia is 70% but in the control group is 90% and the frequency of s alleles in thalassemia is 30% but in the control group is 10% [Table 3]. The genotype dispersion of COLIA1 single-nucleotide polymorphism showed: the SS genotype was higher in group 1c (70%) compared with group 1a + 1b (37.5%); Ss mutant genotypes were higher in group 1a + 1b (52.5%) than in group 1c (25%) and the ss mutant genotypes were higher in group 1a + 1b (10%) than in group 1c (5%) [Table 4].
Table 1: Demographic data, history, and clinical data of the studied groups

Click here to view
Table 2: Laboratory data of the different studied groups

Click here to view
Table 3: distribution of colia1 genotype in thalassemic patients and controls

Click here to view
Table 4: Genotyping distribution and allele frequencies between thalassemic patients with osteoporosis and osteopenia and of those without the bone disease

Click here to view



  Discussion Top


In beta-thalassemia, bone disease in the form of low bone mass represents a chronic degenerative disease, even among well-transfused and iron-chelated prepubertal and adult cases [10]. This study shows the association of COLIA1 gene polymorphism with osteoporosis in thalassemia major. In the present study, there was significant positive correlation between Z-score values and degree of severity of bone disease in thalassemic groups than controls. This agrees with AyferGozu et al. [11] who showed lower BMD in beta-thalassemia that affects the severity of bone disease. However, Christoforidis et al. [12] reported that BMD Z-scores were within normal. In the present study, no statistically significant difference between long duration of iron chelator intake and low BMD. This agrees with the results of Hala et al. [13] which showed a significant negative correlation between long duration of iron chelator intake and low BMD. However, Shamshiraz et al. [14] found that the duration of chelation therapy was associated with low BMD. In the present study, the data showed significant hypocalcemia in subgroups of beta-thalassemia compared with controls. This agrees with Saboor et al. [15] who reported biochemical hypocalcemia in beta-thalassemia patients. However, Morabito et al. [16] found no difference in serum calcium between the thalassemic group and controls. The present study shows high alkaline phosphatase in the thalassemia group than controls. This agrees with Goyal et al. [17]. However, Dundar et al. [18] reported no statistically significant variations in alkaline phosphatase. The present study show statistically significant difference between serum level of ferritin and BMD in thalassemic patients than in controls. This agrees with Asif et al. [19] who reported same relation between ferritin and BMD. However, in the study by Fouzia et al. [20] significant negative correlation was observed between high ferritin level and low BMD in thalassemic patients. In the present study, the SS genotype in thalassemia is 48.3% but higher in the control group (80%); the Ss genotype in thalassemia is 43.3 but lower in the control group (20%); and the ss genotype in thalassemia is 8.3 but in the control group it is 0%. The frequency of S alleles in thalassemia is 70% but in the control group it is 90% and the frequency of s alleles in thalassemia is 30% but in control group is 10%. In other studies such as Naglaa et al. [21] it was reported that the SS genotype (G/G) in thalassemia major and control was 30.7 and 79.5%, respectively. The Ss genotype (G/T) in thalassemia major and control was 55.63 and 20.5%, respectively. The ss genotype (T/T) in beta-thalassemia was 13.67% only. Singh et al. [22] reported in his study that the SS genotype, Ss, and ss are 19, 40, and 43%, respectively, with 37.7% S, 61.3% s allelic frequencies in thalassemic persons. Galal et al. [23] reported that 80.6% of the beta-thalassemia patients were homozygous for SS (G/G) and 19.4% were heterozygotes for Ss (G/T) polymorphism, Guzeloglu-Kayisli et al. [24] There was Ss, SS, and ss genotypes in 24.3, 40.5, and 35.2% of patients, and in 16 and 84% of the control group, respectively.


  Conclusion Top


The genotyping of the COLIA1 gene plays an important role in identifying the thalassemic patients at risk of developing osteoporosis, so early detection of mutation of the COLIA1 gene help to initiate preventive therapy before fractures occur in thalassemic patients.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Hapgood G, Walsh T, Cukierman R, Paul E, Cheng K, Bowden DK. Erythropoiesis is not equally suppressed in transfused males and females with β-thalassemia major: are there clinical implications? Haematologica 2015; 100:292–294.  Back to cited text no. 1
    
2.
Agostino G, Nancy M, Antonino C, Rosario R, Anastasia X, Antonino L. Pathogenesis of thalassemia major–associated osteoporosis. J Clin Res Pediatric Endocrinol 2018; 74:1–16.  Back to cited text no. 2
    
3.
Paola P, Maria DR, Francesco C, Ernesto C, Maurizio M, Eugenio Q, et al. Screening and early diagnosis of osteoporosis through X-ray and ultrasound based techniques. World J Radiol 2013; 5:398–410.  Back to cited text no. 3
    
4.
Duran C, Yardanur K, Praveen S, Nicos S. Osteoporosis in thalassemia major: an update and the I-CET 2013 recommendations for surveillance and treatment. Pediatric Endocrinol Rev 2013; 11:167–180.  Back to cited text no. 4
    
5.
Silverio P, Francesco B, Achille I. Osteoporosis in β-thalassaemia major patients: analysis of the genetic background. Br J Haematol 2000; 111:461–466.  Back to cited text no. 5
    
6.
Gistelinck C, Gioia R, Tonelli F, Marchese L, Bianchi L, Landi C, et al. Zebrafish collagen type I: molecular and biochemical characterization of the major structural protein in bone and skin. Sci Rep 2016; 6:224–235.  Back to cited text no. 6
    
7.
Huibert B, Qiuju H, Fang Y, Fiona EA. Relation of alleles of the collagen type ia1 gene to bone density and the risk of osteoporotic fractures in postmenopausal women. N Engl J Med 1998; 338:1016–1021.  Back to cited text no. 7
    
8.
Navarro MC, Sado M, Torres A, Salido E, Saavedra P, Corral GL, et al. Collagen type 1 (COLIA1) Sp1 binding site polymorphism is associated with oateoporotic fractures but not with bone density in post-menopausal women from the Canary Islands: a preliminary study. Aging Clin Exp Res 2007; 19:4–9.  Back to cited text no. 8
    
9.
Prezybylowska K, Kluczna A, Zadrozny M, Krawczyk T, Kuling A, Rykala J, et al. Polymorphisms of the promotor regions of matrix metalloproteinases genes MMP-1 and MMP-9 in breast cancer. Breast Cancer Treat 2006; 95:65–72.  Back to cited text no. 9
    
10.
Voskaridou E, Terpos E, Cappellini MD, Cohen A, Porter J, Taher A, et al. Guidelines for the management of transfusion dependent thalassemics. 3rd ed. Nicosia, Cyprus: Thalassemia International Federation; 2014. 170–176.  Back to cited text no. 10
    
11.
AyferGozu P, Veysi A, Orhan K, Kenan H, Murat S. Bone mineral density in children with beta-thalassemia major in Diyarbakir. Bone 2011; 49:819–823.  Back to cited text no. 11
    
12.
Christoforidis A, Kazantzidou E, Tsatra I, Metaxa MA. Normal lumbar bone mineral density in optimally treated children and young adolescents with B-thalassemia major. Hormones 2007; 6:334–340.  Back to cited text no. 12
    
13.
Hala FS, Moshera EZ, Mona H, Somaia MM, Amal R. Osteoporosis in b-thalassemia major patients: role of COLIA1 gene G-T polymorphism. Med J Cairo Univ 2009; 77:193–199.  Back to cited text no. 13
    
14.
Shamshiraz A, Bekheirnia M, Kamgar M, Pakbaz Z, Tabatabaie S, Bouzari N, et al. Bone mineral density in Iranian adolescents and young adults with beta-thalassemia major. Pediatr Hematol 2007; 24:469–479.  Back to cited text no. 14
    
15.
Saboor M, Qudsia F, Qamar K, Moinuddin M. Levels of calcium, corrected calcium, alkaline phosphatase and inorganic phosphorus in patients' serum with β-thalassemia major on subcutaneous deferoxamine. J Hematol Thromb 2014; 2:2329–8790.  Back to cited text no. 15
    
16.
Morabito N, Gaudio A, Lasco A, Atteritano M, Pizzoleo MA, Cincotta M, et al. Osteoprotegerin and RANKL in the pathogenesis of thalassemia-induced osteoporosis: new pieces of the puzzle. J Bone Miner Res 2004; 19:722–727.  Back to cited text no. 16
    
17.
Goyal M, Abrol P, Lal H. Parathyroid and calcium status in patients with thalassemia. Indian J Clin Biochem 2010; 25:385–387.  Back to cited text no. 17
    
18.
Dundar U, Kupesiz A, Ozdem S, Gilgil E, Tuncer T, Yesilipek A, et al. Bone metabolism and mineral density in patients with beta-thalassemia major. Saudi Med J 2007; 28:1425–1429.  Back to cited text no. 18
    
19.
Asif M, Manzoor Z, Farooq MS, Kanwal A, Shaheen U, Munawar SH, et al. Correlation between serum ferritin level and liver function tests in thalassemia patients blood transfusions. Int J Res Med Sci 2014; 2:988–994.  Back to cited text no. 19
    
20.
Fouzia I, Asma A, Mazher I. Frequency of low bone mineral density and osteoporosis in children with beta thalassemia major. Pak J Med Health Sci 2015; 9:1073–1076.  Back to cited text no. 20
    
21.
Naglaa AK, Mervat AH, Nadia AE, Alaa AO, Doaa MA. Study of relationship between sp1 polymorphism in the collagen type i alpha-1 (COLIA1) gene and osteoprosis in patients with beta-thalassemia. Zagazig Uni Med J 2017; 23:30–42.  Back to cited text no. 21
    
22.
Singh K, Agarwal S, Gupta S. An SP1-binding site polymorphism in the COLIAI gene: may be a strong predictor for low bone density in thalassemia major. Gene Ther Mol Biol 2013; 15:112–119.  Back to cited text no. 22
    
23.
Galal A, Hanan MH, Mona EL, Hussein IR. An SP1-binding site polymorphism in the COLIAI gene and osteoporosis in Egyptian patients with thalassemia major. Blood Coagul Fibrinolysis 2011; 22:81–85.  Back to cited text no. 23
    
24.
Guzeloglu-Kayisli O, Cetin Z, Keser I, Ozturk Z, Tuncer T. Relationship between Sp1 polymorphism, osteoporosis in b thalassemia major patients. Pediatr Int 2008; 50:474–476.  Back to cited text no. 24
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4]



 

Top
 
 
  Search
 
Similar in PUBMED
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Patients and Methods
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed56    
    Printed0    
    Emailed0    
    PDF Downloaded10    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]