Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2020  |  Volume : 33  |  Issue : 1  |  Page : 210-216

Herpes virus incidence after liver transplantation


1 Department of Clinical Pathology, Faculty of Medicine, Benha University, Benha, Egypt
2 Department of Clinical Pathology, National Liver Institute, Shebein El Kom, Egypt
3 Department of Clinical Pathology, Faculty of Medicine, Menoufia University, Shebein El Kom, Egypt

Date of Submission23-May-2019
Date of Decision10-Jul-2019
Date of Acceptance14-Jul-2019
Date of Web Publication25-Mar-2020

Correspondence Address:
Wesam E Hamed
Clinical Pathology Department, National Liver Institute, Menoufia University, Shebein El Kom, Menoufia
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/mmj.mmj_185_19

Rights and Permissions
  Abstract 

Objective
To study the incidence of herpes virus infection after liver transplantation (LT).
Background
Viral infections are common after LT patients; human cytomegalovirus (HCMV) infection is considered as the most frequent one. Human herpes virus 6 (HHV-6) can cause primary infection or reactivation from latency in LT recipients. Many techniques are used for viral load identification. Multiplex real-time PCR reduces test costs, improves turnaround times, and increases test throughput.
Patients and methods
This study was conducted on 70 patients, comprising 40 LT patients who presented to Surgical Department, National Liver Institute, Menoufia University. and 30 age-matched and sex-matched healthy donors a control group, in the period from 2014 to 2018. HCMV and HHV-6 were determined by multiplex PCR analysis once before and twice (1 and 3 months, correspondingly) after LT.
Results
Our study detected HCMV in six cases 3 months after LT, whereas HHV-6 was detected in only two cases.
Conclusion
LT could be associated with increased incidence of HCMV and HHV-6.

Keywords: human cytomegalovirus, human herpes virus 6, liver transplantation, multiplex real-time PCR


How to cite this article:
Ismail YM, Farid AA, Alhendy AA, Elshalakany AH, Hamed WE. Herpes virus incidence after liver transplantation. Menoufia Med J 2020;33:210-6

How to cite this URL:
Ismail YM, Farid AA, Alhendy AA, Elshalakany AH, Hamed WE. Herpes virus incidence after liver transplantation. Menoufia Med J [serial online] 2020 [cited 2020 Mar 30];33:210-6. Available from: http://www.mmj.eg.net/text.asp?2020/33/1/210/281268




  Introduction Top


Cytomegalovirus (CMV) infection is the most common viral infection in liver transplant (LT) recipients, affecting post-transplant patient and graft survival. Many advances in diagnosis and management of CMV have led to marked reduction in incidence, severity, and its associated morbidity and mortality[1].

Once infected, an individual probably carries CMV for life. The infection usually remains latent. The sites of persistent or latent infection probably include multiple cell types and various organs[2]. Despite its high worldwide prevalence, CMV infections are generally unapparent, except in newborns and immunocompromised individuals, for whom they can cause life-threatening disease affecting many organ systems[3].

The genomic sequences of human cytomegalovirus (HCMV) and human herpes virus 6 (HHV-6) are extremely closely homology related[4]. HHV-6 was isolated in 1986 from the lymphocytes of immunodeficient patients[5]. Its prevalence is very high in the general population throughout the world. Primary HHV-6 infection usually occurs early in childhood and can cause exanthema subitum. Almost all children are infected during the first 2 years of life, which leads to a high seroprevalence, more than 95% in adults[6]. HHV-6 can remain in the host after primary infection and can be reactivated under immunosuppression[7].

Several studies have observed an association between HHV-6 infection and CMV disease. HHV-6 antigenaemia regularly precedes CMV antigenaemia and has been implicated as the probable cause of graft dysfunction[8].

The aim of this study is to study the incidence of herpes virus infection after LT.


  Patients and Methods Top


This prospective cohort study was carried out at Clinical Pathology Department, National Liver Institute, Menoufia University, in the duration from 2014 to 2018. The study was conducted on 70 patients, comprising 40 LT patients presented to Surgical Department, National Liver Institute, Menoufia University and 30 healthy donors as a control group, in the duration from 2014 to 2018. HCMV and HHV-6 were determined by multiplex PCR analysis before LT and at 1 and 3 months after the transplantation. The study protocol was approved by the Local Ethics Committee of the Menoufia University. Informed consents were taken from both the patients and control group before the beginning of the study.

For all patients, history was taken and relevant clinical examination was done. Additionally, basic laboratory tests, including complete blood count and liver function tests; HCMV (IgG and IgM); and molecular testing for CMV and HHV-6 by multiplex real-time (PCR) were done.

For HCMV and HHV-6 assay, a blood sample was collected in a vacationer tube containing K2 EDTA, centrifuged at 3000 rpm for 5 min to separate plasma into aliquots, and stored at −80°C until further analysis.

Total DNA was extracted from 2.0 ml of plasma sample using Thermo Scientific Gene JET Viral DNA Purification kit (Thermo Scientific, Lithuania, Europe), in accordance with manufacturer's recommendations. Spectrophotometric determination of extracted DNA purity was performed by NanoDrop 2000 (Thermo Scientific, Wilmington, Delaware, USA).

Multiplex real-time PCR was performed by QuantiTect Multiplex PCR Kits (Qiagen, Hilden, Germany), which provided accurate real-time PCR quantification of DNA targets of HCMV and HHV-6 in a multiplex format. CMV Mixture included forward primer, 5'-GACTAGTGTGATGCTGGCCAAG-3'; reverse primer, 5'-GCTACAATAGCCTCT TCCTCATCTG-3'; and probe, 5'-FAM-AGCCT GAGGTTATCAGTGTAATGAAGC GCC-BHQ1a-3'. HHV-6 Mixture included forward primer, 5'-TTTGCAGTCATCACGATCGG-3'; reverse primer, 5'-AGA GCGACAAATTG GAGGTTTC-3'; and probe, 5'-JOE-AGCCACA GCAGCCATCTACATCTGTCAA-BHQ3a-3'. Reaction mix was prepared by mixture of 10 μl of QuantiTect Multiplex PCR Master Mix, 2 μl of CMV mixture, and 2 μl of HHV-6 Mixture, and then 5 μl of template DNA was added and completed by 1 μl RNase-free water to reach 20 μl total volume.

The PCR amplification and viral load detection of HCMV and HHV-6 by means of multiplex real time PCR were performed by Applied Biosystem AB7500 Analyzer (Singapore), which was pre-programmed under the following conditions: an initial activation step at 95°C for 15 min, followed by denaturation at 94°C for 60 s, and annealing/extension at 60°C for 60 s for 40-50 cycles. Standard calibration curves generated in multiplex real-time PCR by Serial dilutions of each viral standard ranging from 10 to 105 copies were used to generate the two standard curves of CMV and HHV-6. Cycle of the threshold value (Ct) that corresponded to the PCR cycle number was plotted against the copy number of each viral standard.

Statistical methods

Results were statistically analyzed by using statistical package of the social sciences (SPSS 22.0; IBM/SPSS Inc., Chicago, Illinois, USA) Two types of statistical analysis were conducted. For quantitative data, they were summarized as mean, SD, median, and interquartile range, and for qualitative data, frequency with percentage was expressed. The used tests were Pearson χ2, Fisher's exact, Student's t-test, and Mann–Whitney test. Pearson χ2-test was used to compare between two or more groups regarding one qualitative variable. Fisher's exact test was used instead of χ2-test when the assumption that at least 80% of the expected frequencies are greater than five was violated. Student's t-test was used for continuous data to test for significant difference between two normally distributed groups. Assumptions of normality in each group were verified using Shapiro–Wilk test. Mann–Whitney test was used when normality was violated to compare between two groups of skewed data.


  Results Top


Before transplantation, there was high statistical significance between the two studied groups (donors, recipients) regarding the age (P < 0.001), and there was no statistical significance between the two studied groups regarding the sex (P = 0.685; [Table 1].
Table 1: Comparison between donor and recipient groups regarding demographic parameters

Click here to view


The CMV infection serostatus (IgM and IgG) in donors and recipients before LT was analyzed. The results showed negative CMV IgM and positive CMV IgG in all donors and recipients (D+/R + IgG), so they were categorized as the intermediate-risk group [Table 2]. Moreover, CMV multiplex PCR was analyzed before LT, and the results showed negative CMV PCR [Table 2].
Table 2: Tests of cytomegalovirus before and after liver transplantation for donors and recipients (donor+/recipient+IgG)

Click here to view


HHV-6 Multiplex PCR results in the donors and recipients before LT were analyzed. The results showed negative HHV-6 PCR in all donors and recipients [Table 3].
Table 3: Multiplex PCR test of human herpes virus 6 before and after liver transplantation for donors and recipients

Click here to view


After 1 month of LT, CMV multiplex PCR result was analyzed in donors and recipients. Regarding donors, no positive cases were found, whereas in the recipients, two positive cases were presented after 1 month [Table 2]. Regarding HHV-6 multiplex PCR, there were no positive cases in donors or recipients [Table 3].

After 3 months of LT, CMV multiplex PCR analysis showed no positive cases in donors, whereas the recipients presented four additional positive cases with total of six positive cases with incidence rate of 15% after three months [Table 2]. For HHV-6 multiplex PCR, the results showed two positive cases in the recipients; one of them also had a positive result for CMV PCR [Table 3].

Comparison of age in the CMV-infected recipients with negative recipients revealed no significant difference (P = 0.343). Regarding sex, the comparison narrowly missed the statistical significance (P = 0.055) with predominance of females (66.7%) in infected CMV cases [Table 4].
Table 4: Comparison between negative and positive PCR subgroups for cytomegalovirus in recipients regarding demographics parameters

Click here to view


The changes in laboratory parameters (difference between after-before transplantation) were compared between CMV-positive and CMV-negative PCR subgroups in the recipients. A high significant difference between the two subgroups regarding changes in Alanine transaminase (ALT), Aspartate transaminase (AST), Alkaline phosphatase (ALP), and Gamma glutamyl transferase (GGT) (P < 0.01) was observed, as the enzyme activities were decreased in negative CMV PCR subgroup, whereas increased in the positive CMV PCR subgroup. On the contrary, there were no significant differences for the changes in Total bilirubin (T-Bil), Direct bilirubin (D-Bil), Albumin (ALB), total protein (TP), international normalized ratio (INR), urea, and creatinine (P ≥ 0.05) between CMV-positive and CMV-negative PCR subgroups in the recipient group [Table 5].
Table 5: Comparison between cytomegalovirus-positive and cytomegalovirus-negative PCR in the recipient group regarding the change in laboratory parameters (difference between after and before transplantation)

Click here to view



  Discussion Top


Viral infections are common after LT among patients. Nosocomial infections, opportunistic infections, and viral infections owing to immunocompromised state of the patients occur during the first 6 months after LT. CMV infection as the most frequent viral infection after LT is associated with higher risks of other opportunistic infections and graft loss and a higher mortality[9]. CMV serology to detect IgG and IgM has limited role for diagnosis in post-LT recipients but define the serostatus of patient before transplantation[1]. HHV-6 can cause primary infection or reactivation from latency in LT recipient[10].

Multiplex PCR assays have many advantages compared with singleplex assays. For example, with multiplexing, test costs are reduced; turnaround times are improved with increasing the test throughput. These benefits have a positive effect on clinical service, allowing clinicians to tailor patient management or to begin antiviral therapy more quickly[11].

The aim of this cohort prospective study was to evaluate the incidence of CMV and HHV-6 by multiplex PCR after LT.

In this study, serostatus of CMV before LT was revealed, as all the recipients were positive (R+) and all the donors also positive were (D+), so this group was in the intermediate risk. Meanwhile, in the first 3 months after LT, six patients had positive CMV which contributed to the incidence of 15%.

These results are in agreement with Bruminhent and Razonable[12] who found that CMV disease among liver recipients who are not receiving antiviral prophylaxis occurs most commonly during the first 3 month after transplantation. In their study, the incidence of CMV disease in LT recipients who were CMV seropositive (CMV R+) in the absence of prevention strategy was between 8 and 19%, whereas they estimated an overall incidence of CMV disease between 18 and 29% in all-risk groups. They reported a marked reduction in the incidence of CMV disease in LT recipients who received 3 months of valganciclovir or oral ganciclovir prophylaxis. In addition, the study by Kowalsky et al.[13] demonstrated that 75 patients (15.0% of the study cohort) had an active CMV infection in the first 3 months. Moreover, Caston et al.[14] reported 48 (49%) CMV cases within the first year after surgery.

Eid et al.[15] reported that in addition to donor and recipient CMV serostatus, risk factors for CMV-related complications following LT include age of donor and recipient, type and intensity of immunosuppression, time since transplantation, other coinfections, and presence of acute and chronic rejection.

In this study, the female sex was more prevalent in positive CMV cases after 3 months of transplantation (66.77%); however, the difference was not sufficient for statistical significance, which may be owing to low number of positive cases in our study. These results were in line with the analysis by Brusch et al.[9], who identified female sex as a risk factor for early LT. Supporting our results, an increasing number of studies have described sex differences in the context of etiology, disease severity of liver diseases, and outcomes related to LT[16]. Burra et al.[17] found that there might be interdependence between female sex and higher risk of viral infections.

In this study, the median age in positive CMV recipients did not differ significantly from the negative CMV recipients, revealing no risk for viral infection after LT. These findings were in agreement with Brusch et al.[9], who found no association between age and the risk for viral infections in the early post-LT period. Moreover, a retrospective study was conducted by Ikegami et al.[18] on the outcomes of elderly LT recipients, where 46 patients of at least 65 years of age (mean age 49.8 ± 11.2 years) were compared with 365 recipients younger than 65 years, with an average follow-up period of 5.7 ± 3.0 years, and the study found that age did not influence the occurrence of viral infectious events.

In this study, the assay of laboratory tests at 3 months after transplantation indicated an obvious elevation in liver enzymes. This was in agreement with Razonable[19] who reported that CMV hepatitis led to elevated transaminases. Furthermore, CMV not only has direct effects on tissue but also has indirect effects resulting from its ability to modulate the immune system. CMV is a potent upregulator of alloantigen, which increases the risk of rejection and chronic allograft dysfunction.

HHV-6 is often reactivated from latency during periods of intense immunosuppression, although sporadic cases of HHV-6 reactivation have been reported even in the immunocompetent[20]. In this study, we use plasma for detection of herpes 6 virus. Madan and Hand[21] reported that quantitative PCR from plasma or serum is widely available and is preferred over whole blood or Peripheral blood monocyte cells (PBMC) for diagnosis of active infection; these fluids are relatively cell free but may still contain viral DNA from lysed cells. Quantitative HHV-6 DNA PCR from plasma is reported to be ∼84% specific for actively replicating virus. Moreover, Phan et al.[10] stated that the frequency of HHV-6 reactivation after LT was approximately the same in plasma (33%) and PBMCs (34%), whereas the rate of whole blood was only 19%.

In this study, in the first 3 months after LT, two patients had positive HHV-6 which contributed to the incidence of 5%. This was in agreement with a literature study conducted by Phan et al.[10], which monitored 34 LT recipients (17 adult, 17 pediatrics) not given antiviral prophylaxis. They detected HHV-6 in 20.6% of patients, and viremia occurred briefly without clinical symptoms. Moreover, Pischke et al.[22] stated that detection of herpes virus 6 DNA in blood samples was associated with a shorter survival (P = 0.003). All-cause mortality is higher in patients after LT with HHV-6 reactivation or infection.

In this study, there was one positive case of HHV-6 in recipients which was coinfected with CMV; this finding could not reveal association between HHV-6 and CMV infections. However, Nasimfar et al.[23] observed in several studies an association between HHV-6 infection and CMV disease. In addition, a study by Sampaio et al.[24] reported 23 (51.1%) cases with CMV infection in LT recipients and HHV-6 infection in 12 (26.7%) patients, and those who had reactivated HHV-6 infection were 3.5 times (P = 0.02) more likely to experience severe CMV-associated disease.

In a literature study of Phan et al.[10], in 33 consecutive LTs, HHV-6 was detected by qualitative PCR in 11 (33%) patients. As is common with ubiquitous viruses, the association between CMV and HHV-6 was stronger when quantitative viral load, rather than qualitative DNA detection, was use. Although high HHV-6 viral loads were detected in three (27%) of 11 CMV donor+/recipient − patients, high HHV-6 levels were not detected in either 15 CMV donor+/recipient + or 7 CMV donor−/recipient − patients (P = 0.037). Of the 10 patients who had symptomatic CMV disease, four had high HHV-6 levels (P = 0.02), and eight had either high HHV-6 or HHV-7 levels (P < 0.001). The results from these studies strongly suggest an interaction between β-herpes viruses, particularly HHV-6 and CMV. Symptoms primarily attributed to CMV may be the result of a coinfection and not just the effects of a CMV infection.

In this study, no cases were reported with transplant rejection at the follow-up time of 3 months. Chronic allograft LT rejection develops slowly over a period of months or years and is a main cause of late graft loss. In fact, the onset is usually within several months after transplantation[25]. Chronic allograft LT rejection was associated with persistent CMV replication[26]. Van den Berg et al.[27], in a retrospective study, confirmed there was no association between CMV infection and chronic allograft LT rejection. Unfortunately, many studies about antiviral therapy for CMV failed to show an association between the development of CMV disease and the occurrence of rejection.[28].


  Conclusion Top


This study supports the utility of multiplex real-time PCR for detection of CMV and HHV-6 and for follow-up and management of LT recipients considering the technique's benefits in saving time, cost, and labor.

To investigate the effect of more risk factors, we recommend a larger study covering the three groups of serostatus of CMV before LT, and a large study increases the ability to confirm the association between HCMV and HHV-6 after LT. Furthermore, a comparison between multiplex PCR and singleplex assay may explicit the superiority of multiplex assay. Long-term follow-up for patient after LT regarding CMV and HHV-6 by DNA PCR is recommended to figure out the association between their appearance and LT outcome. Early treatment of reactivated latent CMV would help prevent chronic graft rejection.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Yadav SK, Saigal S, Choudhary NS, Saha S, Kumar N, Soin AS. Cytomegalovirus infection in liver transplant recipients: current approach to diagnosis and management. J Clin Exp Hepatol 2017; 7:144–151.  Back to cited text no. 1
    
2.
Wills MR, Poole E, Lau B, Krishna B, Sinclair JH. The immunology of human cytomegalovirus latency: could latent infection be cleared by novel immunotherapeutic strategies? Cell Mol Immunol 2015; 12:128–138.  Back to cited text no. 2
    
3.
Boeckh M, Geballe AP. Cytomegalovirus: pathogen, paradigm, and puzzle. J Clin Invest 2011; 121:1673–1680.  Back to cited text no. 3
    
4.
Pradeau K, Couty L, Szelag JC, Turlure P, Rolle F, Ferrat P,et al. Multiplex real-time PCR assay for simultaneous quantitation of human cytomegalovirus and herpesvirus-6 in polymorphonuclear and mononuclear cells of transplant recipients. J Virol Methods 2006; 132:77–84.  Back to cited text no. 4
    
5.
Salahuddin SZ, Ablashi DV, Markham PD, Josephs SF, Sturzenegger S, Kaplan M,et al. Isolation of a new virus, HLBV in patients with lymphoproliferative disorders. Science 1986; 234:596–601.  Back to cited text no. 5
    
6.
Karlsson T, Mannonen L, Loginov R, Lappalainen M, Höckerstedt K, Lautenschlager I. Development of a new quantitative real-time HHV-6-PCR and monitoring of HHV-6 DNA aemia after liver transplantation. J Virol Methods 2012; 18:25–36.  Back to cited text no. 6
    
7.
Razonable RR, Paya CV. The impact of human herpesvirus-6 and -7 infection on the outcome of liver transplantation. Liver Transpl 2002; 8:651–658.  Back to cited text no. 7
    
8.
Harma M, Hockerstedt K, Lyytikainen O, Lautenschlager I. HHV-6 and HHV-7 antigenemia related to CMV infection after liver transplantation. J Med Virol 2006; 78:800–805.  Back to cited text no. 8
    
9.
Busch CJ, Siegler BH, Werle H, Lichtenstern C, Bruckner T, Heininger A,et al. Risk factors for early viral infections after liver transplantation. Langenbecks Arch Surg 2018; 403:509–519.  Back to cited text no. 9
    
10.
Phan TL, Lautenschlager I, Razonable RR, Munoz FM. HHV-6 in liver transplantation: a literature review. Liver Int 2018; 38:210–223.  Back to cited text no. 10
    
11.
Gunson RN, Maclean AR, Shepherd SJ, Carman WF. Simultaneous detection and quantitation of cytomegalovirus, Epstein–Barr virus and adenovirus by use of real-time PCR and pooled standards. J Clin Microbiol 2009; 47:765–770.  Back to cited text no. 11
    
12.
Bruminhent J, Razonable RR. Management of cytomegalovirus infection and disease in liver transplant recipients. World J Hepatol 2014; 6:370–383.  Back to cited text no. 12
    
13.
Kowalsky S, Arnon R, Posada R. Prevention of cytomegalovirus following solid organ transplantation: a literature review. Pediatr Transplant 2013; 17:499–509.  Back to cited text no. 13
    
14.
Caston JJ, Castells L, Varo E, Gomez MA, de la Mata M, Campos-Varela I,et al. Impact of cytomegalovirus infection on severe hepatitis C recurrence in patients undergoing liver transplantation. Transplantation 2016; 100:593–599.  Back to cited text no. 14
    
15.
Eid AJ, Arthurs SK, Deziel PJ, Wilhelm MP, Razonable RR. Clinical predictors of relapse after treatment of primary gastrointestinal cytomegalovirus disease in solid organ transplant recipients. Am J Transplant 2010; 10:157–161.  Back to cited text no. 15
    
16.
Sarkar M, Watt KD, Terrault N, Berenguer M. Outcomes in liver transplantation: does sex matter? J Hepatol 2015; 62:946–955.  Back to cited text no. 16
    
17.
Burra P, Senzolo M, Masier A, Prestele H, Jones R, Samuel D,et al. Factors influencing renal function after liver transplantation. Results from the MOST, an international observational study. Dig Liver Dis 2009; 41:350–356.  Back to cited text no. 17
    
18.
Ikegami T, Bekki Y, Imai D, Yoshizumi T, Ninomiya M, Hayashi H,et al. Clinical outcomes of living donor liver transplantation for patients 65 years old or older with preserved performance status. Liver Transpl 2014; 20:408–415.  Back to cited text no. 18
    
19.
Razonable RR. Cytomegalovirus infection after liver transplantation: current concepts and challenges. World J Gastroenterol 2008; 4:4849–4860.  Back to cited text no. 19
    
20.
Fujita M, Takahashi A, Imaizumi H, Hayashi M, Okai K, Kanno Y,et al. Drug-induced liver injury with HHV-6 reactivation. Intern Med 2015; 54:1219–1222.  Back to cited text no. 20
    
21.
Madan RP, Hand J. Human herpesvirus 6, 7, and 8 in solid organ transplantation: Guidelines from the American Society of Transplantation Infectious Diseases Community of Practice. Clin Transplant 2019; [Epub ahead of print].  Back to cited text no. 21
    
22.
Pischke S, Gösling J, Engelmann I, Schlue J, Wölk B, Jäckel E,et al. High intrahepatic HHV-6 virus loads but neither CMV nor EBV are associated with decreased graft survival after diagnosis of graft hepatitis. J Hepatol 2012; 56:1063–1069.  Back to cited text no. 22
    
23.
Nasimfar A, Sadeghi E, Alborzi A, Sepehrvand N, Ziyaeyan M, Jamalidoust M,et al. The activation of cytomegalovirus and human herpes virus 6 after liver transplantation. Hepat Mon 2018; 18:e11987.  Back to cited text no. 23
    
24.
Sampaio AM, Guardia AC, Milan A, Sasaki AN, Andrade PD, Bonon SHA,et al. Co-infection and clinical impact of human herpesvirus 5 and 6 in liver transplantation. Transplant Proc 2012; 44:2455–2458.  Back to cited text no. 24
    
25.
Cervera C, Fernández-Ruiz M, Valledor A, Linares L, Antón A, Ángeles M,et al. Epidemiology and risk factors for late infection in solid organ transplant recipients. Transplant Infect Dis 2011; 13:598–607.  Back to cited text no. 25
    
26.
Martin-Gandul C, Mueller NJ, Pascual M, Manuel O. The impact of infection on chronic allograft dysfunction and allograft survival after solid organ transplantation. Am J Transplant 2015; 15:3024–3040.  Back to cited text no. 26
    
27.
Van den Berg AP, Klompmaker IJ, Hepkema BG, Gouw AS, Haagsma EB, Lems SP,et al. Cytomegalovirus infection does not increase the risk of vanishing bile duct syndrome after liver transplantation. Transpl Int 1996; 9:S171–S173.  Back to cited text no. 27
    
28.
Shibolet O, Ilan Y, Kalish Y, Safadi R, Ashur Y, Eid A,et al. Late cytomegalovirus disease following liver transplantation. Transpl Int 2003; 16:861–865.  Back to cited text no. 28
    



 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5]



 

Top
 
 
  Search
 
Similar in PUBMED
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Patients and Methods
Results
Discussion
Conclusion
References
Article Tables

 Article Access Statistics
    Viewed28    
    Printed0    
    Emailed0    
    PDF Downloaded5    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]