Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2017  |  Volume : 30  |  Issue : 4  |  Page : 1057-1064

C677T single-nucleotide polymorphism of methylenetetrahydrofolate reductase gene and colorectal cancer


1 Department of Medical Biochemistry, Menoufia University, Shebin El Kom, Egypt
2 Department of General Surgery, Menoufia University, Shebin El Kom, Egypt
3 Department of Clinical Oncology, Menoufia University, Shebin El Kom, Egypt

Date of Submission22-Dec-2016
Date of Acceptance03-Mar-2017
Date of Web Publication04-Apr-2018

Correspondence Address:
Sara A Abd El-Rahman El Derbaly
Department of Medical Biochemistry, Menoufia University, Shebin El Kom
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/mmj.mmj_713_16

Rights and Permissions
  Abstract 


Objective
The aim of the study was to investigate the association between methylenetetrahydrofolate reductase gene (MTHFR) C677T single-nucleotide polymorphism (SNP) and colorectal cancer (CRC) in the Egyptian population.
Background
MTHFR is the most critical enzyme in the folate-metabolizing pathway. Its C677T SNP (rs1801133) is the most important one regulating the function of this enzyme, and it has been linked to many types of cancers, cardiovascular diseases, and neurological diseases.
Patients and methods
This study was carried out as a collaborative effort between Departments of Medical Biochemistry, General Surgery, and Clinical Oncology and Nuclear Medicine, Faculty of Medicine, Menoufia University, from May 2015 to December 2015. It was conducted on 70 individuals who were classified into the following groups: group I, subdivided into group Ia and group Ib, and group II. Group I included 50 CRC patients (26 men and 24 women); subgroup Ia included 29 CRC patients under 5-fluorouracil chemotherapy, and subgroup Ib included 21 CRC patients without chemotherapeutic treatment (under follow-up). Group II included 20 healthy controls (11 men and nine women). Laboratory investigations included detection of MTHFR gene C677T SNP (rs1801133) by real-time PCR using the TaqMan allelic discrimination assay.
Results
Results showed that the T/T genotype and the T allele of MTHFR C677T were significantly higher in CRC patients compared with healthy controls (P = 0.01 and 0.009, respectively).
Conclusion
It was concluded that the T allele of MTHFR C677T increases the risk for developing CRC in the Egyptian population, whereas the C allele appeared to have a protective effect.

Keywords: colorectal cancer, methylenetetrahydrofolate reductase, single-nucleotide polymorphism


How to cite this article:
El Shafie MK, S. Radwan EE, A. El Shazly RM, Rageh TM, Alhanafy AM, Abd El-Rahman El Derbaly SA. C677T single-nucleotide polymorphism of methylenetetrahydrofolate reductase gene and colorectal cancer. Menoufia Med J 2017;30:1057-64

How to cite this URL:
El Shafie MK, S. Radwan EE, A. El Shazly RM, Rageh TM, Alhanafy AM, Abd El-Rahman El Derbaly SA. C677T single-nucleotide polymorphism of methylenetetrahydrofolate reductase gene and colorectal cancer. Menoufia Med J [serial online] 2017 [cited 2018 Oct 17];30:1057-64. Available from: http://www.mmj.eg.net/text.asp?2017/30/4/1057/229238




  Introduction Top


In western countries, colorectal cancer (CRC) is the third most commonly diagnosed cancer according to the last registry of the National Cancer Institute, Surveillance Epidemiology, and End results[1]. It is also the fourth most common cause of cancer-related death, attributable to about 8% of all cancer-related death[2].

CRC incidence rates have been rising in developing countries[3], which may reflect an increased prevalence of risk factors for CRC that are associated with westernization, such as unhealthy diet, obesity, and smoking prevalence[4]. The global burden of CRC is expected to increase further because of growth and aging of the population[5].

In Egypt, like most of the developing countries, the incidence of CRC is lower than that of developed countries with a western lifestyle. It is the sixth ranked cancer, representing about 4% of total cancers in both sexes, compared with the USA, in which it holds the third rank, representing about 11%[6]. CRC in Egypt showed a low incidence, with a high proportion of young-onset disease[7]. The incidence is 6.5 per 100 000 for men and 4.2 for women, as reported by the Middle East Cancer Consortium for the period 1999–2001[8].

DNA methylation influences the chromatin structure and gene expression[9]. For correct DNA synthesis, DNA methylation pattern, and DNA repair, a balance between the four deoxyribonucleotides is maintained by folic acid metabolism resulting in the stability and integrity of the genome; therefore, alteration in any enzymatic pathway of folate metabolism may lead to genetic or epigenetic aberrations[10].

Methylenetetrahydrofolate reductase (MTHFR) is one of the key enzymes in folate metabolism that is essential for numerous cellular functions. The enzyme reduces the 5, 10-methylenetetrahydrofolate to its biologically active form, 5-methyltetrahydrofolate, and the latter then donates its methyl group for changing the homocysteine into methionine. Subsequently, methionine provides the methyl group for the formation of S-adenosylmethionine, the methyl donor for DNA and protein methylation[11]. Interconversion of uracil to thymine in DNA synthesis is also performed by methylenetetrahydrofolate. Thus, this enzyme has a root function in balancing the pool of methyl groups in DNA synthesis and DNA methylation[12].

The MTHFR gene is located at the end of the short (p) arm of chromosome 1 at position 36.3 (1p36.3), more precisely; it is located from basepair 11 785 730 to basepair 11 806 103[13] and is composed of 11 exons that encode a protein of 656 amino acids[14].

Single-nucleotide polymorphism (SNP) is the most common form of human genetic variation and may contribute to an individual's susceptibility to cancer. Therefore, genetic susceptibility to cancer has been a research focus in the scientific community[15].

C677T is a SNP at position 677 on the MTHFR gene with the substitution of cysteine to thymine nucleotide at this position. This SNP causes change of alanine to valine in the MTHFR enzyme with resultant reduction of thermostability and activity of the enzyme. MTHFR enzyme activity in homozygous individuals (TT) is 50–60% of normal enzymatic activity in wild-type ones (CC)[16].

Studies have shown that deficiency of folate may raise the incidence of cancer because of increasing depletion of thymidine and continual disincorporation of uracil into DNA, with consequent catastrophic DNA repair, chromosomal aberrations, and potentially malignant transformation[17]. Reduction of methylation of cytosine in DNA due to folate deficiency may also result in the expression of pro-oncogenes. The MTHFR is directly involved in folate metabolism; therefore the MTHFR C677T polymorphism may have direct consequences on cancer incidence[18].

The aim of this study was to determine the association between the C677T SNP of the MTHFR gene and CRC in the Egyptian population.


  Patients and Methods Top


Patients

The study was approved from ethical committee Faculty of medicine menoufia university. This study was carried out at the Departments of Medical Biochemistry, General Surgery, Clinical Oncology, and Nuclear Medicine of the Faculty of Medicine at Menoufia University. It included 70 individuals: 50 patients and 20 age-matched and sex-matched healthy controls selected from Departments of General Surgery and Clinical Oncology, Menoufia University Hospital, from May 2015 to December 2015. The studied participants were categorized into the following groups.

Group I (CRC group): This group included 50 CRC patients (26 men and 24 women; the total number of CRC patients who visited Menoufia university hospitals during the study period). Their ages ranged from 22 to 74 years (mean age: 51.0 ± 12.3 years). This group was divided into subgroup Ia, which included 29 CRC patients under 5-fluorouracil (5-FU) chemotherapy, and subgroup Ib, which included 21 CRC patients without chemotherapeutic treatment (under follow-up).

Group II (control group): This group included 20 apparently healthy individuals (11 men and nine women). Their ages ranged from 25 to 73 years (mean age: 52.9 ± 11.9 years). Informed written consent was obtained from every participant in this study, and the study was approved by the Ethical Committee of Medical Research, Faculty of Medicine, Menoufia University.

The assessment of toxicity of FU-based chemotherapy was based on the National Cancer Institute's Common Terminology Criteria for Adverse Events (NCI-CTC AE), version 2.0[19].

Patients with a history of inflammatory bowel disease, familial adenomatous polyposis, or hereditary nonpolyposis colorectal cancer and patients diagnosed with recurrent colorectal tumors or with tumors located elsewhere were not eligible to participate in this study.

Methods

All studied participants were subjected to the following: full history taking, general clinical examination, abdominal ultrasound and computed tomography scan for the abdomen, colonoscopy, biopsy and histopathological examination (for patients only), metastatic workup including chest radiography and bone scan (for patients only), and laboratory investigations including detection of MTHFR gene C677T SNP in DNA extracted from blood samples, using the TaqMan allelic discrimination assay.

Sample collection

Samples of 3 ml of venous blood were drawn by venipuncture and collected in EDTA-containing tubes for DNA extraction and detection of MTHFR C677T SNP by real-time PCR using TaqMan allelic discrimination assay[20].

Assay methods

The MTHFR C677T SNP was genotyped by real-time PCR using the TaqMan allelic discrimination assay, which detects variants of a single nucleic acid sequence. The presence of two primer/probe pairs in each reaction allows genotyping of the two possible variants at the SNP site in a target template sequence. The actual quantity of target sequence is not determined.

The allelic discrimination assay classifies unknown samples as follows:

  1. Homozygotes (samples having only allele 1 or allele 2)
  2. Heterozygotes (samples having both allele 1 and allele 2).


The assay was carried out in two main steps.

DNA extraction

Blood samples were collected in EDTA-containing tubes. Genomic DNA was extracted from whole blood using the Quick-gDNA MiniPrep Kit (Zymo Research; 2015)[21].

Real-time polymerase chain reaction genotyping

Real-time PCR genotyping was performed using TaqMan universal master mix II (2×), and primers and probes supplied by Applied Biosystem (Foster City, California, USA; 2010).

The following primers were used as described by Kristensen et al.[22]: forward primer 5′-TGAAGGAGAAGGTGTCTGCGGGA-3′ and reverse primer 5′-AGGACGGTGCGGTGAGAG TCGGGT-GGA-3′.

Probes were described by the manufacturer as follows: [VIC/FAM]: GAAAAGCTGCGTGATGATGAAATCG[C/T] CTCCCGCAGACACCTTCTCCTTCAA.

The genotyping reaction mix was prepared by mixing 12.5 μl of master mix, 1.25 μl of SNP assay, and 6.25 μl of DNAse-free water. For each unknown reaction, 5 μl (0.1 μg/μl) of genomic DNA template was added, and for the negative control reaction 5 μl of DNAse-free water was added.

The cycling parameters were set as follows: initial denaturation step at 94°C for 4 min, 50 cycles of denaturation at 94°C for 30 s, annealing/collection at 50°C for 25 s, extension at 72°C for 40 s, and a final extension step at 72°C for 3 min using the Applied Biosystems 7500 software (version 2.0.1).

Statistical analysis

Data were collected, tabulated, and statistically analyzed using an IBM personal computer with statistical package for the social science (SPSS, version 20.0, 2011 and Epi Info 2000 programs; IBM, Armonk, New York).


  Results Top


The results of the present study are presented in [Table 1],[Table 2],[Table 3],[Table 4],[Table 5],[Table 6].
Table 1: Demographic data of the studied groups

Click here to view
Table 2: Statistical comparison of methylenetetrahydrofolate reductase C677T genotype and allele distribution between the studied groups

Click here to view
Table 3: Statistical comparison of methylenetetrahydrofolate reductase C677T genotypes among the studied colorectal cancer patients with respect to metastasis

Click here to view
Table 4: Statistical comparison of methylenetetrahydrofolate reductase C677T genotypes among the studied colorectal cancer patients with respect to grading, staging, and size of the tumor

Click here to view
Table 5: Statistical comparison of methylenetetrahydrofolate reductase C677T genotypes among the studied colorectal cancer patients under 5-fluorouracil chemotherapy with respect to GIT toxicity

Click here to view
Table 6: Statistical comparison of methylenetetrahydrofolate reductase C677T genotypes among the studied colorectal cancer patients under 5-fluorouracil chemotherapy with respect to hematological toxicity

Click here to view


There was a nonsignificant statistical difference between the CRC patients and controls as they were matched in terms of age and sex [Table 1].

There was a significant statistical difference in C677T MTHFR genotypes between CRC patients and healthy controls regarding TT genotype and T allele (P = 0.01 and 0.009, respectively).

A significant association was found between T allele and the risk of developing CRC (odds ratio = 1.34, confidence interval 95% = 1.10–1.64) [Table 2].

There was a highly significant statistical difference in distant metastasis among different C677T genotypes and also a significant statistical difference in lymphatic metastasis, with the TT genotype being significantly higher in both cases [Table 3].

There was a nonsignificant statistical difference in tumor stage, grade, and size among different C677T genotypes [Table 4].

There was a significant statistical difference between CC and TT genotypes with respect to diarrhea, with 20% of the TT genotype having grade I toxicity and 40% having grade III, whereas neither CT nor CC genotype patients developed grade III diarrhea. Moreover, there was a nonsignificant statistical difference among the three different C677T genotypes with respect to vomiting and oral mucositis [Table 5].

There was a significant statistical increase in total leukocyte count, absolute neutrophil count, platelet count, and hemoglobin level between CC and TT genotypes, and a nonsignificant statistical difference among the different C677T genotypes regarding fever neutropenia [Table 6].


  Discussion Top


CRC is a very heterogeneous disease. Molecular and genetic features of the tumor determine the prognosis and response to treatment[23]. The etiology of CRC is complex as it results from multistep carcinogenesis. These alterations can be either acquired or inherited[24].

MTHFR is located at a crucial biochemical crossway, as it catalyzes the reaction that determines whether cellular folate is diverted into biological methylation or nucleotide synthesis[25]. Reduced MTHFR enzymatic activity, due to C677T polymorphism, decreases the commitment toward DNA methylation, which may lead to DNA hypomethylation and oncogene activation but favors thymidylate synthesis. This occurs with poor dietary folate[26].

The present study aims to evaluate the association between MTHFR C677T SNP and CRC in the Egyptian population.

In the present study, there was a nonsignificant statistical difference between patients and controls regarding age and sex. This agreed with the studies of Ghanadi et al.[27], Ozen et al.[28], and Khan et al.[29].

In this study, 18% of cancerous cases were younger than age 40 years.

This is in agreement with the results reported by Elbatea et al.[30], who found that 14% of CRC patients were less than 40 years old, and with the findings of Gado et al.[8], who stated that 25% of CRC patients were under the age of 40.

In the present study, a significant statistical difference in MTHFR C677T was found between CRC patients and healthy controls regarding TT genotype and T allele (P = 0.01 and 0.009, respectively).

These findings are in line with the findings of El-baz et al.[31], Yin et al.[32], and Ozen et al.[28], who found a significant statistical difference in TT genotype and T allele between patients and healthy controls (P< 0.05).

On the other hand, the studies of Derwinger et al.[33] and Promthet et al.[34] reported a nonsignificant statistical difference in T and C alleles between patients and controls, with a slight increase in CC genotype among controls.

In this study, a significant association was found between T allele and the risk of developing CRC (odds ratio = 1.34, confidence interval 95%=1.10–1.64).

These results matched with those of Yin et al.[32], Teng et al.[35], Ozen et al.[28], and Shiao and Yu[36], who found that TT variant genotypes and T allele of the MTHFR C677T polymorphism were significantly associated with increased CRC risk.

This disagreed with the results reported by Fernández-Peralta et al.[37], Zhou et al.[38], and Youssef et al.[39], who found that the variant allele of C677T has a protective effect on CRC development.

These conflicting results regarding the associations between MTHFR C677T polymorphisms and risk for CRC can be attributed to the differences in racial origin of the population, lifestyle, and pattern of diet in different countries[40]. It seems that the protective effect of this folate-related polymorphism is achieved only under adequate levels of folate intake, and this relationship could be inverted when the dietary folate supply is deficient[41].

This protective effect may be attributed to global hypomethylation in association with the MTHFR polymorphism that can limit DNA strand breakage in tissues of colorectal epithelium or bone marrow that require high DNA synthesis, thus playing a protective role in CRC and leukemia[36].

In this study, results showed a highly significant statistical difference in distant metastasis among different C677T genotypes and also a significant statistical difference in lymphatic metastasis, with the TT genotype being significantly higher in both cases.

In agreement with our results, Osian et al.[42] found that MTHFR TT genotype patients develop distant metastasis more frequently.

Also, Derwinger et al.[33] reported that there were tendencies for patients with the CT/TT genotype to have more positive lymph nodes in stage III.

In contrast to our study, Zhu et al.[43] found a nonsignificant statistical difference among different C677Tgenotypes with respect to metastasis of the tumor (P > 0.05).

In this study, results showed nonsignificant statistical difference in degree of tumor differentiation (grading) among different C677T genotypes.

This agreed with the studies of Osian et al.[42] and Fernández-Peralta et al.[37], who found that level of differentiation of the tumor did not demonstrate any associations with MTHFR genotypes.

On the other hand, Naghibalhossaini et al.[44] observed that the TT genotype increased significantly in both well-differentiated and moderately differentiated CRC compared with poorly differentiated CRC.

In this study, results showed a nonsignificant statistical difference in tumor stage among differentC677T genotypes.

This agreed with the study of Fernández-Peralta et al.[37], who did not find any association between the MTHFR polymorphism and stage of tumor.

In contrast to our results, Le Marchand et al.[45] found a protective association in TT genotype patients with regard to advanced stages of CRC, whereas Guimarães et al.[46] reported a statistically significant excess of the MTHFR 677TT in patients with advanced tumor stage (IV) compared with MTHFR 677 CC.

Regarding the toxic effects of 5-FU-based chemotherapy in CRC patients, results of this study showed statistically significant difference between CC and TT genotypes with respect to diarrhea [sign of gastrointestinal tract (GIT) toxicity], with 40% of TT genotype patients developing grade III diarrhea compared with none of the CT and CC genotype patients.

In agreement with these results Thomas et al.[47] found that the CC genotype tended to be protective against grade III diarrhea.

In contrast to our results, Sharma et al.[48] found that the 677TT genotype was associated with a lower incidence of grade III toxicity (P< 0.05). These results were contrary to the expectation that MTHFR polymorphisms enhance 5-FU cytotoxicity. As there is no obvious pharmacological explanation for this, the results may have been affected by the small sample size[49].

On the other hand, Afzal et al.[50] found that MTHFR individual polymorphisms were not associated with treatment-related GIT toxicity.

In this study, results showed a significant statistical increase in total leukocyte count, absolute neutrophil count, platelet count, and hemoglobin level between CC and TT genotypes, and a nonsignificant statistical difference among different C677T genotypes regarding fever neutropenia, liver function tests (aspartate aminotransferase, alanine aminotransferase, and total bilirubin levels), kidney function tests (serum creatinine level), hand and foot syndrome, oral mucositis, and vomiting. Thus, different C677T genotypes were not associated with toxic manifestations regarding these parameters.

This is in agreement with the studies of Afzal et al.[51], Kristensen et al.[22], van-Huis Tanga et al.[49], and Botticelli et al.[52].

On the other hand, Boudaoud et al.[53] reported that patients with the CT genotype had an increased risk of developing severe acute overall toxicity due to FU treatment. The TT genotype was protective against grade III toxicity.


  Conclusion Top


It can be concluded that the C677T polymorphism in the MTHFR gene might be a candidate risk factor for developing CRC, presumably by DNA hypomethylation, which increases proto-oncogene expression in colon cells. Individuals carrying the T allele of the C677T MTHFR gene have increased risk of developing CRC, whereas individuals carrying the C allele have a protective effect against the development of CRC. GIT toxicity manifestations (diarrhea) in response to FU chemotherapeutic treatment were higher among TT genotype carriers.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Mohammed AS, Kandil MA, Asaad NY, Aiad HA, El Tahmoudy MA, Hemida AS. Immunohistochemical expression of Twist in colorectal carcinoma. Menouf Med J 2015; 28:725–733.  Back to cited text no. 1
    
2.
Deen KI, Silva H, Deen R, Chandrasinghe PC. Colorectal cancer in the young, many questions, few answers. World J Gastrointest Surg 2016; 8:481–488.  Back to cited text no. 2
    
3.
Jemal A, Bray F, Center MM, Ferlay J, Ward EM, Forman D. Global cancer statistics. CA Cancer J Clin 2011; 61:69–90.  Back to cited text no. 3
    
4.
Martin JJ, Hernandez LS, Gonzalez MG, Mendez CP, Rey Galan C, Guerrero SM. Trends in childhood and adolescent obesity prevalence in Oviedo (Asturias, Spain) 1992–2006. Acta Paediatr 2008;97:955–958.  Back to cited text no. 4
    
5.
Nowatzki J, Moller B, Demers A. Projection of future cancer incidence and new cancer cases in Manitoba, 2006–2025. Chronic Dis Can 2011; 31:71–78.  Back to cited text no. 5
    
6.
Zeeneldin AA, Saber MA, Seif El-din IA, Frag SA. Colorectal carcinoma in Gharbiah district, Egypt: comparison between the elderly and non-elderly. J Solid Tumors 2012; 2:13–23.  Back to cited text no. 6
    
7.
Veruttipong D, Soliman AS, Gilbert SF, Blachley TS, Hablas A, Ramadan M, et al. Age distribution, polyps and rectal cancer in the Egyptian population-based cancer registry. World J Gastroenterol 2012; 18:3997–4003.  Back to cited text no. 7
    
8.
Gado A, Ebeid B, Abdelmohsen A, Axon A. Colorectal cancer in Egypt is commoner in young people: is this cause for alarm?. Alex J Med 2014; 50:197–201.  Back to cited text no. 8
    
9.
Dhillon VS, Shahid M, Husain SA. Associations of MTHFR DNMT3b 4977 bp deletion in mtDNA and GSTM1 deletion, and aberrant CpG island hypermethylation of GSTM1 in non- obstructive infertility in Indian men. Mol Hum Reprod 2007; 13:213–222.  Back to cited text no. 9
    
10.
Ravel C, Chantot-Bastaraud S, Chalmey C, Barreiro L, Aknin-Seifer I. Lack of association between genetic polymorphisms in enzymes associated with folate metabolism and unexplained reduced sperm counts. PLoS One 2009; 4:1–8.  Back to cited text no. 10
    
11.
Zc A, Yang Y, Zhang SZ, Li N, Zhang W. Single nucleotide polymorphism 677CT in the methylenetetrahydrofolate reductase gene might be a genetic risk factor for infertility for Chinese men with azoospermia or severe oligozoospermia. Asian J Androl 2007; 9: 57–62.  Back to cited text no. 11
    
12.
Lee HC, Jeong YM, Lee SH, Cha KY, Song SH. Association study of four polymorphisms in three folate-related enzyme genes with non-obstructive male infertility. Hum Reprod 2006; 21:3162–3170.  Back to cited text no. 12
    
13.
National Library of Medicine. Genetics home reference. Bethesda, MD: National Library of Medicine; 2016. Available at: https://ghr.nlm.nih.gov/gene/MTHFR.  Back to cited text no. 13
    
14.
Akram M, Malik FA, Kayani MA. Mutational analysis of the MTHFR gene in breast cancer patients of Pakistani population. Asian Pac J Cancer Prev 2012; 13:1599–1603.  Back to cited text no. 14
    
15.
Shen H, Wang L, Spitz MR, Hong WK, Mao L. A novel polymorphism in human cytosine DNA-methyltransferase-3B promoter is associated with an increased risk of lung cancer. Cancer Res 2002; 62:4992–4995.  Back to cited text no. 15
    
16.
Liew SC, Gupta ED. Methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism: epidemiology, metabolism and the associated diseases. Eur J Med Genet 2014; 58:1–10.  Back to cited text no. 16
    
17.
McKinnon PJ, Caldecott KW. DNA strand break repair and human genetic disease. Annu Rev Genomics Hum Genet 2007; 8:37–55.  Back to cited text no. 17
    
18.
Choi SW, Mason JB. Folate status: effects on pathways of colorectal carcinogenesis. J Nutr 2002; 132:2413–2421.  Back to cited text no. 18
    
19.
Common Toxicity Criteria. National Cancer Institute's Common Terminology Criteria for Adverse Events (NCI-CTC AE) version 2.0; 1999. Available at: http://ctep.cancer.gov/protocolDevelopment/electronic_applications/ctc.htm. [Last accessed on 2008 Jan 08].  Back to cited text no. 19
    
20.
Reeves SG, Meldrum C, Groombridge C, Spiglman AD, Suchi J, Kurzawaski G, et al. MTHFR 677 C>T and 1298 A>C polymorphisms and the age of onset of colorectal cancer in hereditary nonpolyposis colorectal cancer. Eur J Human Genet 2009; 17:629–635.  Back to cited text no. 20
    
21.
Dahm R. Discovering DNA: Friedrich Miescher and the early years of nucleic acid research. Hum Genet 2008; 122:565–581.  Back to cited text no. 21
    
22.
Kristensen MH, Pedersen PL, Melsen GV. Gene variants in DPYD, MTHFR and TYMS predict 5-FU-related toxicity. J Int Med Res 2010; 38:870–883.  Back to cited text no. 22
    
23.
Prenen H, Vecchione L, Van Cutsem E. Role of targeted agents in metastatic colorectal cancer. Target Oncol 2013; 8:83–96.  Back to cited text no. 23
    
24.
Arnold CN, Goel A, Blum HE. Molecular pathogenesis of colorectal cancer. Cancer 2005; 104:2035–2047.  Back to cited text no. 24
    
25.
Sohn KJ, Jang H, Campan M, Weisenberger DJ, Dickhout J, Wang YC, et al. The methylenetetrahydrofolate reductase C677T mutation induces cell-specific changes in genomic DNA methylation and uracil misincorporation: a possible molecular basis for the site-specific cancer risk modification. Int J Cancer 2009; 124:1999–2005.  Back to cited text no. 25
    
26.
Duthie SJ. Folate and cancer: how DNA damage, repair and methylation impact on colon carcinogenesis. J Inherit Metab Dis 2009; 34:101–109.  Back to cited text no. 26
    
27.
Ghanadi K, Anbari K, Obeidavi Z, Pournia Y. Characteristics of colorectal cancer in Khorramabad, Iran during 2013. Middle East J Dig Dis 2014; 6:81–86.  Back to cited text no. 27
    
28.
Ozen F, Sen M, Ozdemir O. Methylenetetrahydrofolate reductase gene germ-line C677T and A1298C SNPs are associated with colorectal cancer risk in the Turkish population. Asian Pac J Cancer Prev 2014; 15:7731–7735.  Back to cited text no. 28
    
29.
Khan NA, Hussain M, Rahman AU, Farooqui WA, Rasheed A, Memon AS. Dietary practices, addictive behavior and bowel habits and risk of early onset colorectal cancer: a case control study. Asian Pac J Cancer Prev 2015; 16:7967–7973.  Back to cited text no. 29
    
30.
Elbatea H, Enaba M, ElKassas G. Indications and outcome of colonoscopy in the middle of Nile delta of Egypt. Dig Dis Sci 2011; 56:2120–2123.  Back to cited text no. 30
    
31.
El-baz R, Abdel Malak CA, El-Awady SI, Kazamel A, El tarpely FA. MTHFR gene polymorphisms as risk factors for colorectal cancer among Egyptian patients. Egyp J Hospital Med 2010; 40:424–434.  Back to cited text no. 31
    
32.
Yin G, Ming H, Zheng X, Xuan Y, Liang J, Jin X. Methylenetetrahydrofolate reductase C677T gene polymorphism and colorectal cancer risk: a case-control study. Oncol Lett 2012; 4:365–369.  Back to cited text no. 32
    
33.
Derwinger K, Wettergren Y, Odin E, Carlsson G, Gustavsson B. A study of the MTHFR gene polymorphism C677T in colorectal cancer. Clin Colorectal Cancer 2009; 8:43–48.  Back to cited text no. 33
    
34.
Promthet S, Pientong C, Ekalaksananan T, Songserm N, Oomphakwaen K, ChopjittP, et al. Risk factors for rectal cancer and methylenetetrahydrofolate reductase polymorphisms in a population in Northeast Thailand. Asian Pac J Cancer Prev 2012; 13:4017–4023.  Back to cited text no. 34
    
35.
Teng Z, Wang L, Cai S, Yu P, Wang J. The 677C.T (rs1801133) Polymorphism in the MTHFR gene contributes to colorectal cancer risk: a meta-analysis based on 71 research studies. PLoS One 2013; 8:1–10.  Back to cited text no. 35
    
36.
Shiao SPK, Yu CH. Meta-prediction of MTHFR gene polymorphism mutations and associated risk for colorectal cancer. Biol Res Nurs 2016; 18:357–369.  Back to cited text no. 36
    
37.
Fernández-Peralta AM, Daimiel L, Nejda N, Iglesias D, Arana VM, Gonzalez-Aguilera JJ. Association of polymorphisms MTHFR C677T and A1298C with risk of colorectal cancer, genetic and epigenetic. Int J Colorectal Dis 2010; 25:141–151.  Back to cited text no. 37
    
38.
Zhou D, Mei Q, Luo H, Tang B, Yu P. The polymorphisms in methylenetetrahydrofolate reductase, methionine synthase, methionine synthase reductase, and the risk of colorectal cancer. Int J Biol Sci 2012; 8:819–830.  Back to cited text no. 38
    
39.
Youssef A, Shomaf M, Berger S, Ababneh N, Bobali Y, Ali D, et al. Allele and genotype frequencies of the polymorphic methylenetetrahydrofolate reductase and colorectal cancer among Jordanian population. Asian Pac J Cancer Prev 2013; 14:4559–4565.  Back to cited text no. 39
    
40.
Zhao J, Li W, Zhu D. Association of single nucleotide polymorphisms in MTHFR and ABCG2 with the different efficacy of first-line chemotherapy in metastatic colorectal cancer. Med Oncol 2014; 31:802–818.  Back to cited text no. 40
    
41.
Lima CS, Nascimento H, Bonadia LC, Teori MT, Coy CS, Goes JR, et al. Polymorphisms in methylenetetrahydrofolate reductase gene (MTHFR) and the age of onset of sporadic colorectal adenocarcinoma. Int J Colorectal Dis 2007; 22:757–763.  Back to cited text no. 41
    
42.
Osian G, Procopciuc L, Vlad L. MTHFR polymorphisms as prognostic factors in sporadic colorectal cancer. J Gastrointestin Liver Dis 2007; 16:251–256.  Back to cited text no. 42
    
43.
Zhu L, Wang F, Hu F, Wang Y, Li D, Dong X, et al., Association between MTHFR polymorphisms and overall survival of colorectal cancer patients in Northeast China. Med Oncol 2013; 30:467–473.  Back to cited text no. 43
    
44.
Naghibalhossaini F, Mokarram P, Khalili I, Vasei M, Hosseini SV, Ashktorab H, et al. MTHFR C677T and A1298C variant genotypes and the risk of microsatellite instability among Iranian colorectal cancer patients. Cancer Genet Cytogenet 2010; 197:142–151.  Back to cited text no. 44
    
45.
Le Marchand L, Wilkens LR, Kolonel LN, Henderson BE. The MTHFR C677T polymorphism and colorectal cancer: the multiethnic cohort study. Cancer Epidemiol Biomarkers Prev 2005; 14:1198–1203.  Back to cited text no. 45
    
46.
Guimarães JLM, Ayrizono M, Coy CSR. Gene polymorphisms involved in folate and methionine metabolism and increased risk of sporadic colorectal adenocarcinoma. Tumor Biol 2011; 32:853–861.  Back to cited text no. 46
    
47.
Thomas F, Motsinger-Reif AA, Hoskins JM, Dvorak A, Roy S, Alyasiri A, et al. Methylenetetrahydrofolate reductase genetic polymorphisms and toxicity to 5-FU-based chemoradiation in rectal cancer. Br J Cancer 2011; 105:1654–1662.  Back to cited text no. 47
    
48.
Sharma R, Hoskins JM, Rivory LP, Zucknick M, London R, Liddle C. Thymidylate synthase and methylenetetrahydrofolate reductase gene polymorphisms and toxicity to capecitabine in advanced colorectal cancer patients. Clin Cancer Res 2008; 14:817–825.  Back to cited text no. 48
    
49.
van-Huis Tanga LH, Gelderblom H, Punt CG, Gucheleer HJ. MTHFR polymorphisms and capecitabine-induced toxicity in patients with metastatic colorectal cancer. Pharmacogenet Genomics 2013; 23:208–218.  Back to cited text no. 49
    
50.
Afzal S, Gusella M, Vainer B, Vogel UB, Andersen JT, Broedbaek K, et al. Combinations of polymorphisms in genes involved in the 5-fluorouracil metabolism pathway are associated with gastrointestinal toxicity in chemotherapy-treated colorectal cancer patients. Clin Cancer Res 2011; 17:3822–3829.  Back to cited text no. 50
    
51.
Afzal S, Jensen SA, Vainer B, Vogel U, Matsen JB, Sorensen JB, et al. MTHFR polymorphisms and 5-FU-based adjuvant chemotherapy in colorectal cancer. Ann Oncol 2009; 20:1660–1666.  Back to cited text no. 51
    
52.
Botticelli A, Borro M, Onesti CE, Strigari L, Gentile G, Cerbelli B, et al. Degradation rate of 5-fluorouracil in metastatic colorectal cancer: a new predictive outcome biomarker. PLoS One 2016; 1:1–13.  Back to cited text no. 52
    
53.
Boudaoud K, Taleb S, Filali T, Boudaoud H, Sifi K, Brihmat A et al. Correlation between methylene tetrahfolate reductase (MTHFR) C677T polymorphism, fluoropyrimidines response and toxicity in patients treated for locally advanced rectal cancer. EC Cancer 2016; 2.2:84–92.  Back to cited text no. 53
    



 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5], [Table 6]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Patients and Methods
Results
Discussion
Conclusion
References
Article Tables

 Article Access Statistics
    Viewed194    
    Printed6    
    Emailed0    
    PDF Downloaded39    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]