Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2016  |  Volume : 29  |  Issue : 4  |  Page : 826-834

Profiling of microRNA-122 in chronic hepatitis C


1 Department of Medical Microbiology and Immunology, National Liver Institute, Menoufia, Egypt
2 Department of Medical Microbiology and Immunology, Faculty of Medicine, Menoufia University, Menoufia, Egypt
3 Department of Biochemistry, National Liver Institute, Menoufia, Egypt

Date of Submission08-Apr-2015
Date of Acceptance22-Jun-2015
Date of Web Publication21-Mar-2017

Correspondence Address:
Fatma O Khalil
Department of Medical Microbiology and Immunology, National Liver Institute, Menoufia University, Kafr Nafra Village, Berket El Sabae, Menoufia
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/1110-2098.202489

Rights and Permissions
  Abstract 

Objective
The aim of this study was to assess the expression level of microRNA-122 (miRNA-122) in the serum as a diagnostic marker of liver injury in chronic hepatitis C, liver cirrhosis, and hepatocellular carcinoma (HCC).
Background
MicroRNAs are small RNA molecules including the liver specific, miRNA-122, which acts as a critical regulator of hepatic gene expression and an essential factor for hepatitis C virus (HCV) replication.
Patients and methods
A total of 112 participants who were divided into four groups were included in the study. Group I included 27 patients with chronic hepatitis C infection. Group II included 27 patients with HCC. Group III included 30 patients with chronic liver cirrhosis. Group IV included 18 healthy individuals without hepatitis C infection or any other disease who served as a control group. Liver function tests, α-fetoprotein, complete blood count, hepatitis C antibody, hepatitis B surface antigen, HCV-RNA using PCR, and detection of miRNA-122 in the serum using real-time PCR were carried out for all groups.
Results
The expression level of serum miRNA-122 displayed a significant fold increase in serum miRNA-122 in the HCV group compared with the other groups (P ≤ 0.0001). Patients with HCC showed a nonsignificantly higher expression level of miRNA-122 as compared with controls. miRNA-122 fold change at cutoff less than 1.64 could predict patients with HCC with 81.4% sensitivity and 48% specificity.
Conclusion
Measurements of serum miRNA-122 may be useful in the evaluation of HCV patients, by permitting with a serum test, the diagnosis of HCC with high predictivity and sensitivity.

Keywords: chronic hepatitis C, hepatocellular carcinoma, microRNA-122


How to cite this article:
Ghoneim EM, Abed El-Aziz AM, Abd El-Mottaleb TM, El-Hendawy GR, El-Ezawy HM, Khalil FO. Profiling of microRNA-122 in chronic hepatitis C. Menoufia Med J 2016;29:826-34

How to cite this URL:
Ghoneim EM, Abed El-Aziz AM, Abd El-Mottaleb TM, El-Hendawy GR, El-Ezawy HM, Khalil FO. Profiling of microRNA-122 in chronic hepatitis C. Menoufia Med J [serial online] 2016 [cited 2020 Feb 16];29:826-34. Available from: http://www.mmj.eg.net/text.asp?2016/29/4/826/202489


  Introduction Top


Hepatitis C virus (HCV) is the most common etiology of chronic liver diseases in Egypt that is complicated by liver cirrhosis and hepatocellular carcinoma (HCC). HCC is the third leading cause of cancer-related deaths among chronic liver patients [1].

MicroRNAs (miRNAs), a family of short (average of 20–25 nucleotide long), naturally occurring, small antisense RNAs had emerged as important post-transcriptional regulators of gene expression [2].

miRNAs are predicted to control the activity of more than 60% of all protein coding genes [2]. miRNAs regulate several biological processes such as cell differentiation, apoptosis, and proliferation. What makes miRNAs even more interesting is that several studies had demonstrated that miRNAs are detectable and stable in plasma and serum [3].

miRNA-122 is one of the miRNAs that is highly expressed in the liver, constituting 70% of the total miRNA pool. miR-122 is a target for extensive study due to its association with cholesterol metabolism and HCC, and its important role in promoting HCV replication [4]. It has other names: MIRN122, MIRN122A, hsa-mir-122, miR-122, miRNA-122A, and MIR122A [5].

Because of its liver-specific nature and tumor suppressor-like activities, it is of interest to know whether miR-122 expression is altered in liver cancers. Prior studies investigating miR-122 expression in liver cancers had produced conflicting results [6].

The aim of this study was to investigate whether the serum levels of miRNA-122 may be useful as a diagnostic marker of liver injury in patients with chronic HCV infection and whether it can be used as a marker for the early detection of HCC.


  Patients and Methods Top


This study was carried out on 84 patients with chronic liver disease. The study included 51 male and 33 female patients with a mean age of 45.89 ± 7.16 years who were selected from the outpatient clinic and the inpatient department of the Hepatology Department, National Liver Institute, Menoufia University, during the period from January 2013 to March 2014. According to the laboratory data and abdominal ultrasonography, they were classified into three groups: group I, which included 27 chronic hepatitis C patients (23 male and four female); group II, which included 27 HCC patients (20 male and seven female); and group III, which included 30 cirrhotic patients (18 male and 12 female). The study also included 18 healthy age-matched and sex-matched individuals as a control group. Informed consent was obtained from all patients before the study, and this study was approved by the Ethical Committee of National Liver Institute, Menoufia University.

All patients and controls were subjected to thorough history taking, complete clinical examination, and abdominal ultrasound. Triphasic CT was performed for patients with focal lesion of the liver to diagnose HCC. Laboratory investigations included the following: liver function tests, which were measured using a COBAS INTEGRA 400 plus autoanalyzer (Forrenstrasse CH – 6343 Rotkreuz, Switzerland); complete blood counts, using Sysmex K21 automatic cell counter (Sysmex America, Inc. in Lincolnshire, Illinois, USA); prothrombin concentration estimation with Thrombol – s kit using fibrintimer (Dade Behring-Germany); α-fetoprotein (AFP) evaluation using kit supplied by Roche Diagnostic using COBAS 411 (Indianapolis, USA); and hepatitis B surface antigen and HCV antibody evaluation using enzyme-linked immunosorbent assay. HCV-RNA detection was carried out using PCR for cases with positive HCV antibodies, and detection of miRNA-122 was carried out using RT-PCR [7–11].

Molecular detection of miRNA-122

Molecular detection of miRNA-122 was carried out using RT-Real Time PCR technique in three steps [12].

RNA extraction

miRNA extraction was carried out using miRNeasy Mini Kit (Cat#217004, QIAGEN, GmBH, Germany). This kit is used to extract miRNA-122 from serum.

Reverse transcription step

This step was carried out using miScript II RT Kit (Qiagen). In a reverse transcription reaction with miScript HiSpec Buffer, mature miRNAs were polymerized by poly (A) polymerase and converted into cDNA by reverse transcriptase. The cDNA was then used for real-time PCR quantification of mature miRNA expression.

Real-time PCR for the detection of mature miRNA-122

This step was carried out using miScript SYBR Green PCR Kit (Qiagen) and the Applied Biosystems 7500 fast PCR system (Applied Biosystems, Foster City, California, USA): 2× QuantiTect SYBR Green PCR Master Mix was used, 10× miScript Universal Primer, and 10× miScript Primer Assay which was two types: one that targets the gene of interest (mature miRNA-122: hsa-miR-122-3p, Cat. No. MS00008428), MIMA T000 4590: 5'AACGCCAUUAUCACACUAAAUA 3' (Qiagen), and the reference or housekeeping gene primer (RNU6 Human miRNA) (Qiagen). Cycler was set for 40 cycles. Initial activation step was carried out for 15 min at 95°C. Three-step cycle protocol was used: denaturation for 15 s at 94°C, annealing for 30 s at 55°C, and extension for 30 s at 70°C.

The expression of miRNAs was reported as ΔCt value. The ΔCt was calculated by subtracting the Ct values of miRNA RNU6 from the Ct values of the target miRNAs. The resulting normalized ΔCt values were used in calculating relative expression values using (fold change). These values are directly related to the miRNA expression levels. The method was used to determine relative-quantitative levels of individual miRNAs [12].

Statistical analysis

The data were collected, tabulated, and analyzed using SPSS (Statistical Package for Social Science) version 17.0 on IBM compatible computer (SPSS Inc, Chicago, Illinois, U.S.A). The χ2-test was used to study the association between two qualitative variables. The Student t-test is a test of significance used for comparison between two groups with normally distributed quantitative variables. For quantitative data, statistical significance among all groups was tested using the Kruskal–Wallis nonparametric test. When Kruskal–Wallis was significant, significance between individual groups was tested by applying Tukey's post-hoc test used for assessing multiple comparisons of quantitative data among different groups. The Mann–Whitney U-test, a nonparametric test of significance, was used for comparison between two groups not normally distributed having quantitative variables. Correlation analysis is a statistical process for estimating the relationships among variables [13].


  Results Top


The demographic data of the 84 patients with chronic liver disease and 18 controls are presented in [Table 1]. There were 23 male (85.2%) and four female patients (14.8%) in the HCV group. Their mean age was 53.13 ± 5.64 years. There were 20 male (74.1%) and seven female (25.9%) patients in the HCC group. Their mean age was 52.04 ± 97.13 years. There were 18 male (60%) and 12 female patients (40%) in the liver cirrhosis group, with a mean age of 50.5 ± 8.72 years. There were 13 male (72.2%) and five female participants (27.8%) in the control group. Their mean age was 54.37 ± 7.52 years with no statistically significant difference between different groups. As regards residence, there was rural predominance compared with urban in all groups with no statistical significance.
Table 1 Demographic data of the studied groups

Click here to view


The laboratory data of the studied groups are shown in [Table 2]. The serum levels of aspartate aminotransferase (AST), alkaline phosphatase (ALP), AFP, and γ-glutamyl transferase (GGT) were significantly elevated in the HCC group than in the HCV group, whereas no significant difference was found between the two groups as regards ALT, Tb, Db, and Pc. There was a significant decrease in the serum level of Alb and total protein (TP) in the HCC group than in the HCV group. The serum level of ALT, ALP, and TP were significantly elevated in the HCV group than in the liver cirrhosis group. The serum level of AST, ALT, ALP, GGT, and AFP was significantly higher in the HCC group than in the liver cirrhosis group. Hb% and platelet count were significantly lower in the liver cirrhosis, HCC, and HCV groups compared with the control group.
Table 2 Laboratory data of the studied groups

Click here to view


miR-122 serum levels

Analysis of miRNA-122 expression showed an increased expression level of miRNA-122 in patients' sera in comparison with the control group. Moreover, miR-122 displayed a significant increase in the HCV group (3.2 ± 2) in comparison with other groups [the liver cirrhosis group (1.58 ± 0.86), the HCC group (1.2 ± 0.46), and the control group (1.09 ± 0.0)] (P ≤ 0.0001). Moreover, the expression level of miRNA-122 was elevated in the HCC than in the control group, although not significant [Figure 1].
Figure 1: miRNA-122 fold change in the studied groups.

Click here to view


There was a highly significant positive correlation between miRNA-122 fold change and ALT and direct bilirubin (P < 0.05). Furthermore, there was a significant negative correlation between miRNA-122 fold change and ALP (P < 0.05). There were no significant positive or negative correlations as regards other laboratory data ([Table 3]).
Table 3 Correlation between miRNA-122 fold change and laboratory data

Click here to view


All patients were HCV-Ab-positive. The expression level of miRNA-122 in patients was significantly higher (2 ± 1.5) compared with controls (1.09 ± 0.55) (P < 0.05) [Figure 2].
Figure 2: miRNA-122 fold change in relation to the presence of hepatitis C antibodies.

Click here to view


The study showed that the HCV group had significantly high viremia compared with the HCC group and the liver cirrhosis group ([Table 4]). The expression of miRNA-122 was higher in patients with high viremia than in those with moderate and low viremia, although not significant (P > 0.05) ([Table 5]).
Table 4 Level of viremia in the studied groups

Click here to view
Table 5 miRNA-122 fold change in relation to hepatitis C virus load

Click here to view


miRNA-122 expression level at a cutoff value of greater than 1.69 (P < 0.0001) had the sensitivity of 74.1% and the specificity was 81% in discriminating HCV from non-HCV [Figure 3].
Figure 3: Receiver operating characteristic (ROC) curve of miRNA-122 discriminating patients with hepatitis C virus (HCV).

Click here to view


miRNA-122 at a cutoff of less than 1.64 could predict patients with HCC with a sensitivity of 81.4% and specificity of 48% [Figure 4].
Figure 4: Receiver operating characteristic (ROC) curve for miRNA-122 fold change in hepatocellular carcinoma (HCC).

Click here to view


miRNA-122 expression had a sensitivity of 76.7% and specificity of 37.5% at a cutoff of greater than 1.12 and could discriminate between cirrhotic and noncirrhotic cases among HCV patients [Figure 5].
Figure 5: Receiver operating characteristic (ROC) curve of miRNA-122 for discrimination between cirrhotic and noncirrhotic.

Click here to view



  Discussion Top


miRNAs are being investigated in HCV infection, with the most popular one being miRNA-122, which is the most abundant miRNA in the liver where it has many important biological roles, such as in fatty acid metabolism and circadian rhythms under normal conditions. miRNA-122 was found to interact with HCV-RNA, thus enhancing its replication [14].

The aim of this study was to investigate whether the serum levels of miR-122 may be useful as a disease parameter in patients with chronic HCV infection and whether it can be used as a marker for the early detection of HCC.

The present study showed that the studied groups were age matched (P > 0.05). Similar results were reported by Ezzat et al. [15].

However, El-Garem et al. [12] found that there was a significant difference between the diseased groups as regards age (P < 0.001).

As regards sex, our study showed that there was male predominance, with no significant difference between groups.

These results are in agreement with those of Ezzat et al. [15] and El-Garem et al. [12].

The study showed that the serum levels of AST, ALP, and GGT were significantly elevated in the HCC group than in the HCV group, whereas no significant difference was found between the two groups as regards ALT, Tb, Db, and Pc. There was a significant decrease in the serum level of Alb and TP in the HCC group than in the HCV group. The serum level of ALT, ALP, and TP was significantly higher in the HCV group than in the liver cirrhosis group. There were significant differences between the liver cirrhosis and the HCC group as regards AST, ALT, ALP, GGT, Tb, and TP.

These results are in agreement with the study by Zekri et al. [16], who reported that liver function tests were significantly elevated in HCC patients (P < 0.001) when compared with liver cirrhosis and HCV patients. Spaniel et al. [17] also mentioned that ALT in patients with HCC was significantly higher than that in the control group (P < 0.05). The findings of Baghdady et al., are in agreement with our results as they mentioned that the serum levels of ALT and AST were significantly higher in the HCC compared with the HCV and control groups (Ps < 0.05) [18].

The present study showed that the serum level of AFP was significantly higher in the HCC group than in the HCV, liver cirrhosis, and control groups. Similar results were reported by Baghdady et al. [18], Bahnassy et al. [19], and Mousa et al. [20].

An elevated AFP (>400 ng/ml) level was associated with advanced disease stage in HCC patients. However, some studies showed that AFP had a low specificity for diagnosing HCC; therefore, other reliable biomarkers are required to complement ultrasound and AFP for proper diagnosis and early detection of HCC [21].

In this study, it was found that the level of expression of miR-122 in the studied patient was higher than that in controls. Within the studied patients, the level of serum miRNA-122 expression was significantly higher in the HCV group in comparison with other groups.

These result are in agreement with those of Bihrer et al.[22], El-Garem et al. [12], and Waidmann et al. [23], who reported that sera from patients with HCV contained higher levels of miRNA-122 compared with sera from healthy controls.

In agreement with these results, Ezzat et al. reported that the mean expression level of miRNA-122 was significantly higher in both patients with chronic HCV infection and cirrhotic patients with and without HCC as compared with the control group (P < 0.001) [15]. The findings of Cermelli et al. [24] are in agreement with these results as they reported that serum levels of miRNA-122 may represent novel, noninvasive biomarkers for the diagnosis of patients with HCV.

The current study revealed a significant increase in circulating miRNA-122 expression level in patients with liver cirrhosis as compared with the control group. However, there was no significant difference between HCC and liver cirrhosis as regards the expression level of miRNA-122.

This finding is in agreement with that of Ezzat et al., who reported that elevated expression of miRNA-122 did not differ significantly between patients with HCC and those with liver cirrhosis alone [15]. Köberle et al. [25] and Bihrer et al. [22] reported similar results. As liver cells contain a high concentration of miR-122, it might be speculated that, during liver injuries or pathogenic infection, miRNA secretion is increased as a strategy of cell adaptation for adverse conditions [22].

In contrast, El-Garem et al. showed that significant fold decrease was noticed in the expression level of miRNA-122 in cirrhotic patients, in comparison with normal controls [15].

The present study showed that the serum expression level of miR-122 in the HCC group was higher in comparison with the normal control group.

Comparable results were reported by El-Garem et al. [15] and Trebicka et al. [26], as there was fold rise in serum expression level of miR-122 in the HCC group in comparison with the normal control group. miR-122 might downregulate the target miRNA of tumor suppressor genes and thus lead to further tumor growth [26]. Ruoquan et al. [27] and Varnholt et al. [28] reported similar results. Cancer-induced hepatocyte damage would release the abundant intracellular miR-122 into the circulation, and hence the stability of miRNA would be reflected by easily detectable high blood levels [28].

However, Thibault et al. [5] reported that miRNA expression is often dysregulated or abolished in cancer cells, all of which had etiologies other than HCV infection. Moreover,

Ladeiro and Zucman-Rossi [29] had established a significant downexpression of miR-122 in 28 HCC liver tissues (mixed etiologies other than HCV) in comparison with four healthy liver tissues using qRT-PCR. Differences in miR-122 expression in HCV versus non-HCV HCC likely reflect virus-specific mechanisms contributing to carcinogenesis. The continued expression of miR-122 in HCV-associated HCC may signify an important role for HCV replication late in the progression [17].

Siaj and colleagues reported that it was noticed that elevated levels of miR-122 in serum correspond well with a range of liver diseases, including viral infection, fibrosis, and HCC. Serum miR-122 fulfills several criteria for a novel biomarker of liver disease, as it is highly abundant in the liver and almost absent in other organs [30].

The current study showed that, as regards the severity of liver diseases, we assessed the correlation of the expression level of miRNA-122 to liver function tests, we found that there was a significant positive correlation between the expression level of miRNA-122 and ALT and direct bilirubin, and a negative correlation with ALP. However, there were no significant correlations between miRNA-122 and other laboratory data.

These results are in agreement with those of Bihrer et al. [22] and Waidmann et al. [23], who reported that the serum level of miR-122 was positively correlated with ALT and necroinflammatory activity in chronic hepatitis C patients. Köberle et al. [25] also reported similar results.

In the present study, it was shown that HCV viral load was lower in the HCC group in comparison with the HCV and liver cirrhosis groups.

This result is in agreement with that of Zekri et al. [16], who found that log-HCV titer was significantly lower in HCC patients (P < 0.001) when compared with chronic hepatitis and chronic liver disease patients – that is, HCV levels were markedly higher in noncancerous liver than in HCC (P = 0.001).

As regards the relation between the viral load and the expression level of miRNA-122, we found an increase in the expression level of miRNA in patients with high viral load.

These results are in agreement with that of Kumar et al. [6], who reported a significant positive correlation between miR-122 level and HCV-RNA load. Morita et al. [31] also reported comparable results.

This may be speculated that upon viral infection miRNAs might be passively released from the damaged or dying cells. However, other possible mechanisms might be linked to the virus itself, which can also elicit the secretion of miRNAs from host cells to influence the cellular physiology for their production. These assumptions may be correlated with our observations that miR-122 level elevated as the severity of infection increases [6].

In this study, miRNA-122 expression level at a cutoff value of greater than 1.69 (P < 0.0001) was used as a predictor for HCV infection with a sensitivity of 74.1%, specificity of 81%, positive predictive value of 50%, and negative predictive value of 88.7%.

The present study showed that miRNA-122 expression level at a cutoff of less than 1.64 as predictor for HCC had a sensitivity of 81.4%, specificity of 48%, positive predictive value of 36.1%, and negative predictive value of 87.8%.

miRNA-122 expression with a sensitivity of 76.7% and a specificity of 37.5% at a cutoff of greater than 1.12 could discriminate between cirrhotic and noncirrhotic cases among HCV patients.


  Conclusion Top


The study concluded that the expression of miRNA-122 was increased in chronic HCV infected than in cirrhotic and HCC patients, and hence can be used in the evaluation of HCV patients, by permitting with a serum test, the diagnosis of HCC with high predictivity and sensitivity.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
  References Top

1.
Bosch FX, Ribes J, Diaz M, Cleries R. Primary liver cancer: worldwide incidence and trends. Gastroenterology 2004; 127:S5–S16.  Back to cited text no. 1
    
2.
Borchert GM, Lanier W, Davidson BL. RNA polymerase III transcribes human microRNAs. Nat Struct Mol Biol 2006; 13:1097–1101.  Back to cited text no. 2
    
3.
Velázquez R, Rodríguez M, Navascués C, Linares A, Pérez R, Sotorríos N, et al. Prospective analysis of risk factors for hepatocellular carcinoma in patients with liver cirrhosis. Hepatology 2003; 37:520–527.  Back to cited text no. 3
    
4.
Jopling C. Liver-specific microRNA-122: biogenesis and function. RNA Biology 2012; 9:137–142.  Back to cited text no. 4
    
5.
Thibault P, Huys A, Dhillon P, Wilson J. MicroRNA-122-dependent and -independent replication of hepatitis C virus in Hep3B human hepatoma cells. Virology 2013; 436:179–190.  Back to cited text no. 5
    
6.
Kumar S, Chawla Y, Ghosh S, Chakraborti A. Severity of hepatitis C virus (genotype-3) infection positively correlates with circulating microRNA-122 in patients sera. Dis Markers 2014; (2014):435–476.  Back to cited text no. 6
    
7.
Bergmeyer H, Hoder M, Rej R. Approved recommendation on IFCC methods for the measurement of catalytic concentration of enzymes. J Clin Chem 1985; 24:481–495.  Back to cited text no. 7
    
8.
Horsti J. Pre analytical aspects of routine coagulation measurements. J Clin Lab Invest 2001; 61:167–168.  Back to cited text no. 8
    
9.
Feitelson M. Biology of hepatitis B virus variants. Lab Invest 1994; 71:324.  Back to cited text no. 9
    
10.
Pawlotsky J. Interpretation of virological tests for hepatitis C. Hepatology 2002; 36:65–73.  Back to cited text no. 10
    
11.
Su T, Liu C, Chen C, Ting T, Tseng T, Chen P, et al. Serum microRNA-122 level correlates with virologic responses to pegylated interferon therapy in chronic hepatitis C. Proc Natl Acad Sci USA 2013; 110:7844–7849.  Back to cited text no. 11
    
12.
El-Garem H, Ammer A, Shehab H, Shaker O, Anwer M, El-Akel W, Omar H. Circulating microRNA, miR-122 and miR-221 signature in Egyptian patients with chronic hepatitis C related hepatocellular carcinoma. World J Hepatol 2014; 6:818–824.  Back to cited text no. 12
    
13.
Morton R, Hebel J, McCarter R. A study guide to epidemiology and biostatistics. Med Stat 2002; 5:71–74.  Back to cited text no. 13
    
14.
Chang J, Guo JT, Jiang D, Guo H, Taylor JM, et al. Liver-specific microRNA miR-122 enhances the replication of hepatitis C virus in non-hepatic cells. J Virol 2008; 82:8215–8223.  Back to cited text no. 14
    
15.
Ezzat H, Lotfy A, Alalfy M, El-Taher S, Mokhtar A, Mohamed S, EL-Senosy F. The significance of circulating micro RNA-122 as a non invasive diagnostic marker of liver injury in Egyptian chronic hepatitis C virus infected and cirrhotic patients with and without hepatocellular carcinoma. Clin Med Diagn 2014; 4:1–8.  Back to cited text no. 15
    
16.
Zekri AN, El-din HM, Bahnassy AA. Serum levels of soluble Fas, soluble tumor necrosis factor-receptor II, interleukin-2 receptor and interleukin-8 as early predictors of hepatocellular carcinoma in Egyptian patients with hepatitis C virus. Comp Hepatol 2010; 95:1–12.  Back to cited text no. 16
    
17.
Spaniel C, Honda M, Selitsky SR, Yamane D, Shimakami T, Kaneko S, et al. microRNA-122 abundance in hepatocellular carcinoma and non-tumor liver tissue from Japanese patients with persistent HCV versus HBV infection. PloS One 2013; 8:76867.  Back to cited text no. 17
    
18.
Baghdady I, Fouad F, Sayed M, Shoaib A, Salah Y, Elshayeb E, Hasan AE. Serum markers for the early detection of hepatocellular carcinoma in patients with chronic viral hepatitis C infection. Menoufia Med J 2014; 27:544–550.  Back to cited text no. 18
    
19.
Bahnassy AA, Zekri AR, El-Bastawisy A, Fawzy A, Shetta M, Hussein N, et al. Circulating tumor and cancer stem cells in hepatitis C virus-associated liver disease. World J Gastroenterol 2014; 20:18240–18248.  Back to cited text no. 19
    
20.
Mousa MM, El-Saeid ME, Hamdy MM, Ibrahim HM, Magdi MSa, Mohamed HA. Evaluation of cystatin C, fibronectin and alpha-feto protein as biochemical markers in patients with liver diseases. J Am Sci 2012; 8:770–779.  Back to cited text no. 20
    
21.
Masuda T, Miyoshi E. Cancer biomarkers for hepatocellular carcinomas: from traditional markers to recent topics. Clin Chem Lab Med 2011; 49:959–966.  Back to cited text no. 21
    
22.
Bihrer V, Waidmann O, Friedrich-Rust M, Forestier N, Susser S, Haupenthal J, et al. Serum microRNA-21 as marker for necroinflammation in hepatitis C patients with and without hepatocellular carcinoma. PloS One 2011; 6:26971.  Back to cited text no. 22
    
23.
Waidmann O, Bihrer V, Pleli T, Farnik H, Berger A, Zeuzem S, et al. Serum microRNA-122 levels in different groups of patients with chronic hepatitis B virus infection. J Viral Hepat 2012; 19:58–65.  Back to cited text no. 23
    
24.
Cermelli S, Ruggieri A, Marrero JA, Ioannou GN, Beretta L. Circulating microRNAs in patients with chronic hepatitis C and non-alcoholic fatty liver disease. PloS One 2011; 6:e23937.  Back to cited text no. 24
    
25.
Köberle V, Kronenberger B, Pleli T, Trojan J, Imelmann E, Peveling-Oberhag J, et al. Serum microRNA-1 and microRNA-122 are prognostic markers in patients with hepatocellular carcinoma. Eur J Cancer 2013; 49:3442–3449.  Back to cited text no. 25
    
26.
Trebicka J, Anadol E, Elfimova N, Strack I, Roggendorf M, Viazov S, et al. Hepatic and serum levels of miR-122 after chronic HCV-induced fibrosis. J Hepatol 2013; 58:234–239.  Back to cited text no. 26
    
27.
Ruoquan Y, Wanpin N, Qiangsheng X, Guodong T, Feizhou H. Correlation between plasma miR-122 expression and liver injury induced by hepatectomy. J Int Med Res 2014; 42:77–84.  Back to cited text no. 27
    
28.
Varnholt H, Drebber U, Schulze F, Wedemeyer I, Schirmacher P, Dienes HP, Odenthal M. MicroRNA gene expression profile of hepatitis C virus-associated hepatocellular carcinoma. Hepatology2008; 47:1223–1232.  Back to cited text no. 28
    
29.
Ladeiro Y, Zucman-Rossi J. miRNAs in cancer: the case of liver tumors. Med Sci 2009; 25:467–472.  Back to cited text no. 29
    
30.
Siaj R, Sauer V, Stoppeler S, Gerss J, Spiegel HU, Kohler G, et al. Longitudinal analysis of serum miR-122 in a rat model of Wilson's disease. Hepatol Int 2012; 6:770–777.  Back to cited text no. 30
    
31.
Morita K, Taketomi A, Shirabe K, Umeda K, Kayashima H, Ninomiya M, et al. Clinical significance and potential of hepatic microRNA-122 expression in hepatitis C. Liver Int 2011; 31:474–484.  Back to cited text no. 31
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Patients and Methods
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed682    
    Printed0    
    Emailed0    
    PDF Downloaded93    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]