Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2016  |  Volume : 29  |  Issue : 1  |  Page : 160-166

Study of clinical significance of protein tyrosine phosphatase-1B gene polymorphism in essential hypertension and dyslipidemia


1 Department of Clinical Pathology, Faculty of Medicine, Menoufiya University, Shebin El-Kom, Menofiya, Egypt
2 Department of Internal Medicine, Faculty of Medicine, Menoufiya University, Shebin El-Kom, Menofiya, Egypt

Date of Submission09-May-2014
Date of Acceptance15-Jun-2014
Date of Web Publication18-Mar-2016

Correspondence Address:
Noran T Abo El-khair
Department of Clinical Pathology, Faculty of Medicine, Menoufiya University, 22 Sameh Mubarak st., Shebin El-Kom, Menofiya
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/1110-2098.179008

Rights and Permissions
  Abstract 

Objectives
The aim of the study was to investigate the role of protein tyrosine phosphatase-1B (PTP-1B) gene polymorphism in essential hypertension and dyslipidemia.
Background
Essential hypertension is the most common chronic disease and an important risk factor for major health problems. PTP-1B has been recognized as a key modulator of several important physiological pathways. Multiple SNPs of PTP-1B have been shown to be associated with diseases accompanying insulin resistance, such as dyslipidemia and hypertension.
Participants and methods
The study included 57 individuals divided into two groups: group I comprised 37 hypertensive patients and group II comprised 20 healthy individuals as controls. The participants were subjected to the following: history taking and clinical examination, assessment of weight, height, and BMI, fasting blood sugar, lipid profile, renal function tests, and PCR-RFLP for determination of genotype and allele frequencies of the g54281T > A polymorphism of the PTP-1B gene.
Results
Group I had statistically higher fasting blood sugar, weight, BMI, and TG. The TT genotype recorded higher frequency in group II than in group I (70%, 43.2%, respectively). While, AA genotype showed higher frequency in group I than in group II (29.7%, 5%, respectively) and TA genotype was higher in group I than in group II (27%, 25%, respectively). However, the differences were without statistical significance. The T allele was more prevalent in group II (82.5%) than in group I (56.8) and the A allele was more prevalent in group I (43.2%) than in group II (17.5%). TA carried a 1.75-fold higher risk than TT [confidence interval (CI): 0.48-6.36], whereas AA carried a 9.63-fold higher risk than TT (CI: 1.10-84.23). The A allele carried a 3.59-fold higher risk than the T allele (CI: 1.41-9.16). In group I, AA genotype was higher in BMI than TT, also TA and AA genotypes were higher in TG than TT.
Conclusion
The g54281T > A polymorphism of the PTP-1B gene can be implicated in the pathogenesis of essential hypertension.

Keywords: Dyslipidemia, hypertension, protein tyrosine phosphatase-1B


How to cite this article:
Abd El-Halim EF, Khodair SZ, Kora MA, Abou-Elela DM, Abo El-khair NT. Study of clinical significance of protein tyrosine phosphatase-1B gene polymorphism in essential hypertension and dyslipidemia. Menoufia Med J 2016;29:160-6

How to cite this URL:
Abd El-Halim EF, Khodair SZ, Kora MA, Abou-Elela DM, Abo El-khair NT. Study of clinical significance of protein tyrosine phosphatase-1B gene polymorphism in essential hypertension and dyslipidemia. Menoufia Med J [serial online] 2016 [cited 2019 Sep 20];29:160-6. Available from: http://www.mmj.eg.net/text.asp?2016/29/1/160/179008


  Introduction Top


Hypertension is one of the most important public health problems in developed countries. It is the most common chronic disease and is an important risk factor for a variety of major health problems, as it may cause serious damage to different body organs and induce cerebrovascular accidents, coronary heart disease, heart failure, renal failure, and other complications [1]. Essential hypertension (EHT) is the form of hypertension that by definition has no identifiable cause. It is the most common type of hypertension; it tends to be familial and is likely to be the consequence of an interaction between environmental and genetic factors [2]. It is well known that heritable factors contribute to the etiology of hypertension. However, no specific gene mutations have been identified that account for a significant proportion of patients affected by hypertension. Protein tyrosine phosphatase-1B (PTP-1B) is a novel candidate gene for studying IR and its role in the development of obesity and hypertension [3]. PTP-1B plays a key role in many signaling networks in human disorders, particularly in obesity, hyperlipidemia, hypertension, and cancer [4].


  Aim of the work Top


The aim of the study was to investigate the role of PTP-1B gene polymorphism in EHT and dyslipidemia.


  Participants and methods Top


The present study was carried out at the Clinical Pathology Department in collaboration with Cardiology, Neurology and Internal Medicine Departments, Faculty of Medicine, Menoufia University Hospitals. The study included 57 individuals divided into the two groups: group I comprised 37 hypertensive patients (23 men and 14 women), their ages ranging between 46 and 82 years. Group II comprised 20 apparently healthy age-matched and sex-matched individuals who served as the control group (12 men and eight women), their ages ranging between 46 and 81 years. Patients with a history of renal impairment or diabetes were excluded from the study. All participants were subjected to the following tests: history taking, clinical examination, assessment of weight, height, and BMI, fasting blood sugar (FBS), total lipid profile [cholesterol, triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C)], and renal function tests. The PCR-restriction fragment length polymorphism PCR-RFLP method was used to determine the distribution of genotype and allele frequencies of the g54281T > A polymorphism of the PTP-1B gene. Written informed consent was provided by all participants and agreement was obtained from the ethical committee.

Sampling was carried out under complete aseptic conditions. A volume of 8 ml of venous blood was collected after 12 h of fasting and used as follows: 3 ml of whole blood was added to an EDTA-containing sterile tube for the determination of PTP-1B polymorphism and 5 ml of whole blood was added to a sterile plain tube and allowed to clot at 37°C. Serum was separated by centrifugation and used for immediate assay of fasting blood glucose, lipid profile, and kidney function tests.

Laboratory methods

Biochemical tests for evaluation of fasting blood glucose [5], kidney function [urea [6] and creatinine [7]], total cholesterol [8], and TG [8] were performed on a Synchron CX9 autoanalyser using a kit supplied by Beckman. Meanwhile (Beckman Coulter, California, USA), HDL-C was determined with an automated HDL-C [9] assay supplied by Siemens (Germany). LDL-C was determined according to Friedewald equation [10].

DNA analysis

The PCR-RFLP [3] method was used to determine the distribution of genotype and allele frequencies of the g54281T > A polymorphism of the PTP-1B gene. DNA was extracted using a commercially available Spin-column technique kit for DNA extraction from human whole blood (Gene Jet Genomic DNA Purification Kit; Fermentas, Thermo Fisher Scientific, Canada) and was stored in -20°C until PCR was performed.

The PCR amplification was performed in a total volume of 50 μl mixture containing 1 μl genomic DNA, 25 μl 2 Χ PCR MasterMix, 23.5 μl H 2 O, and 0.5 μl of each primer; forward primers CACAACAAGATATGACCTGAGAAC and reverse primers CACCCTACAGAAAAGCAAAGG were used. The mixture was incubated for 5 min at 94°C for initial denaturation, followed by 40 cycles of 30 s at 94°C, 30 s at annealing temperature of 55°C, 30 s at 72°C, and 5 min at 72°C for final extension. The PCR fragments (230 bp) were digested using restriction enzyme Hin1I. The digestion mixture contained 10 μl PCR product, 2 μl restriction enzyme buffer, 1 μl restriction enzyme Hin1I, and 17 μl nuclease-free water. The digested samples were separated by electrophoresis on 2% agarose gel stained with ethidium bromide and visualized on a UV transilluminator. This resulted in the identification of three genotypes: TT yields (230 bp) not divided; AA divided into two fragments (130 and 100 bp); and AT divided into three fragments (230, 130, and 100 bp) [Figure 1].
Figure 1: Agarose gel electrophoresis 2% stained with ethidium bromide showing protein tyrosine phosphatase-1B gene product after digestion with Hin1I; LAN 1, 4, and 5: AT genotype. LAN 2, 3, and 7: TT genotype. LAN 6: AA ge notype.

Click here to view


Statistical analysis

The collected data were analyzed and the descriptive statistics were in the form of mean ± SD for parametric data. The ν2 -test was performed for qualitative variables, the Student t-test was performed for quantitative variables, and the Z-test was performed for analyzing the proportion between two independent groups. Analysis of variance was performed for comparison between three or more groups having quantitative variables normally distributed, followed by least significant difference. The Kruskal-Wallis test was performed for comparison between three or more groups not normally distributed having quantitative variables, followed by Tamhan. The odds ratio and confidence interval (CI) were calculated by logistic regression analysis. Significance was set at 0.05 or less.


  Results Top


In the present study, there were no statistically significant differences between the studied groups regarding age and sex (P = 0.62 and 0.87, respectively). Group I had statistically higher weight and BMI compared with group II (P = 0.004 and 0.001, respectively); meanwhile, there was no statistically significant difference in height between group I and group II (P > 0.05). In [Table 1], group I had statistically higher FBS and TG compared with group II (P = 0.002 and P<0.001, respectively); meanwhile, there were no statistically significant differences in BUN, creatinine, cholesterol, HDL-C, and LDL-C between the two groups (P > 0.05). In [Table 2], the genotype distribution was as follows: the prevalence of the TT genotype was higher in group II (70%) than in group I (43.2%); the prevalence of the TA genotype was higher in group I (27%) than in group II (25%); and the prevalence of the AA genotype was higher in group I (29.7) than in group II (5%). However, these differences did not reach statistical significance. With regard to allele frequency, the frequency of the T allele was higher in group II (82.5%) than in group I (56.8%), whereas that of the A allele was higher in group I (43.2%) than in group II (17.5%), showing statistically significant differences in the distribution of both alleles (T and A). [Table 3] shows that the TA genotype carries a 1.75-fold higher risk for hypertension compared with the TT genotype (CI: 0.48-6.36), whereas the AA genotype carries a 9.63-fold higher risk compared with the TT genotype (CI: 1.1-84.23). The A allele was found to carry a 3.59-fold higher risk compared with the T allele (CI: 1.41-9.16). There was statistically significant difference between genotypes of group I regarding BMI (AA was higher than TT), but there were no statistically significant differences between different genotypes as regards weight and height. In [Table 4], TG levels in the AA genotype were statistically higher than those in the TT genotype and those in the TA genotype were higher than those of the TT genotype; meanwhile, there was no statistically significant difference between TA and AA. In contrast, there were no statistically significant differences between different genotypes as regards FBS, BUN, creatinine, systolic and diastolic blood pressure, total cholesterol, and LDL-C and HDL-C levels.
Table 1: Comparison between the studied groups regarding biochemical tests

Click here to view
Table 2: Comparison between the studied groups as regards genotypes

Click here to view
Table 3: Odds ratio of genotypes and alleles

Click here to view
Table 4: Comparison between genotypes of group I as regards biochemical tests

Click here to view



  Discussion Top


The mean weight and BMI were statistically higher in group I when compared with group II. However, there was no statistically significant difference in height between the two groups. These findings were in accordance with results obtained by Olivier et al. [11] and Gu et al. [3], who reported that EHT patients had significantly high BMI, and BMI is a common risk factor for hypertension and the metabolic syndrome. Also, Hilal et al. [12] found that hypertension risk increases significantly with higher BMI. Moreover, Akande et al. [13] found that BMI was higher in hypertensive patients when compared with controls. Further, Qiao et al. [1] reported that the increase or decrease in body weight can cause an elevation or decline of blood pressure in hypertensive patients. The relation between BP and BMI is explained by an increase in body weight, and thus BMI is related to increases in body fluid volume, peripheral resistance, and cardiac output. It is known that weight loss moderates activation of the renin-angiotensin-aldosterone axis and the sympathetic nervous system and diminishes sodium retention.

Regarding the lipid profile, the mean level of TG in group I was statistically higher than that of group II. However, there were no statistically significant differences in the mean level of cholesterol, HDL-C, and LDL-C between the two groups. The obtained results partially agreed with those of Saha et al. [14], who found that hypertensive patients had significantly elevated total cholesterol, TG, and LDL-C compared with normotensive individuals, with a lack of statistically significant difference in the concentration of HDL-C between them. Saha et al. [14] reported that the higher level of TC, TG, and LDL-C may be due to genetic factors and that increased consumption of dietary animal fat, lack of physical exercise, metabolic disorders, severe stress, increased age, and alcohol and tobacco consumption may also be contributory factors for this phenomenon. Idemudia and Ugwuja [15] agreed with the previous results. Xu et al. [16] found that there were significantly increased levels of TC, TG, and LDL-C in hypertensive patients when compared with normotensive individuals and also a significant decrease in HDL-C in hypertensive patients. They stated that there was significant increase in TG in hypertensive patients and this hypertriglyceridemia might be probably due to hypercoagulability. The increased TG found in hypertension is likely to be deposited in some predisposed vessels, thereby contributing to the endothelial dysfunction resulting in the production of LDL-C and thus elevation in serum LDL-C. In addition, Asaolu et al. [17], Osuji et al. [18], and Pooja et al. [19] agreed with the previous results.

This is unlike the findings of Lepira et al. [20] and Akintunde [21], who reported that the TC, TG, and LDL-C levels of newly diagnosed hypertensive patients did not differ significantly from those of controls.

The abnormal lipid metabolism in hypertensive patients may be due to that the genetic locus responsible for dyslipidemia accompanying hypertension seems to be closely linked to the LDL receptor and insulin receptor locus [22].

In the current study, the TT genotype showed higher frequency in group II (control group) compared with group I (hypertensive group) (70%, 43.2%, respectively); AA genotype was higher in group I compared with group II (29.7%, 5%, respectively); and TA genotype was higher in group I than in group II (27%, 25%, respectively). However, these differences did not reach meaningful statistical significance (P > 0.05). The frequency of the T allele was higher in group II (82.5%) than in group I (56.8%). However, the frequency of the A allele was higher in group I (43.2%) compared with group II (17.5%). Hence, statistically, there were significant differences in the distribution of both alleles (T and A) between group I and group II (P < 0.05). With regard to the odds ratio of genotypes and alleles, the TA genotype carried a 1.75-fold greater risky for hypertension compared with the TT genotype (CI: 0.48-6.36), whereas the AA genotype carried a 9.63-fold greater risk for hypertension compared with the TT genotype (CI: 1.41-84.23). At the same time, the A allele carried a 3.59-fold higher risk for hypertension compared with the T allele (CI: 1.41-9.16).

In agreement with these results, Olivier et al. [11] found that single-nucleotide polymorphism (SNP) g54281T > A is significantly associated with hypertension (P = 0.0206). In addition, Gu et al. [3] found that there were no differences in genotype distributions of g54281T > A, g58585T > C IVS6+G82A, and I5/37C > A between hypertensive and normotensive control groups; meanwhile, the frequency of the T allele of the g54281T > A polymorphism was higher in the hypertensive group than in the control group.

In this study, there were no statistically significant differences between different genotypes of the g54281T > A polymorphism as regards age and sex (P > 0.05). Meanwhile, Di Paola et al. [23] identified that 1484insG variation of the PTP-1B gene was associated with higher blood pressure among Italian women.

In the current study, there was no statistically significant difference between different genotypes of group I regarding weight and height. As regards BMI, the prevalence of the AA genotype was statistically higher than that of the TT genotype, whereas there were no statistically significant differences between TT and TA and TA and AA genotypes. These findings were in accordance with the results of Olivier et al. [11], who found that two SNPs were associated with BMI (g54281T > A and g58585T > C). In other studies of different gene variants, Chantemθle et al. [24] reported that PTP-1B deletion induced a slight increase in body weight. They found that disruption of the PTP-1B gene increases mean arterial pressure, supporting the clinical association between PTP-1B gene variants and systolic blood pressure and that PTP-1B disruption increased the sympathetic tone and enhanced the mean arterial pressure, highlighting the possible deleterious consequences of global PTP-1B inhibitors in obese patients already prone to the development of hypertension. Similarly, Gu et al. [3] reported that individuals carrying the T allele of g58585T > C had a significantly higher BMI when compared with CC homozygous individuals (P = 0.0308). Moreover, Spencer-Jones et al. [25] studied SNPs representing 18 common variants in the PTP-1B gene but they did not find any significant effect of the PTP-1B variant on weight or BMI.

There were no statistically significant differences between different genotypes in the hypertensive group as regards systolic and diastolic blood pressure (P > 0.05). Spencer-Jones et al. [25] studied SNP rs718049 of PTP-1B and found a significant association of this SNP with systolic blood pressure (P = 0.046).

There were no statistically significant differences between different genotypes in the hypertensive group as regard FBS, BUN, and creatinine. Mok et al. [26] found that individuals with the PTP-1B 981T/981C genotype were less likely to have either IGT or type 2 diabetes compared with individuals with the 981C/981C genotype. Echwald et al. [27] in a Danish study reported that a rare Pro387Leu variant was associated with type 2 diabetes. Also, Spencer-Jones et al. [25] found that SNP rs718049 was significantly associated with fasting glucose (P = 0.022). Meanwhile, Gu et al. [3] reported that no SNP was found to be associated with plasma levels of fasting glucose.

Regarding the lipid profile, the TG level in the AA and TA genotypes was statistically higher than in TT genotype (P < 0.05). These results could be explained by the fact that PTP-1B regulates adiposity and expression of genes involved in lipogenesis, such as sterol regulatory element binding protein 1, fatty acid synthase, lipoprotein lipase, and peroxisome proliferator activated receptor (PPARg). Gu et al. [3] reported that the homozygote for the T allele of the PTP-1B g54281T > A polymorphism (TT subjects) tended to have the highest LDL-C and triglyceride levels compared with individuals with the AA or AT subjects. The contradictory observation might be due to differences in population heterogeneity, sample size, or gene environment.

In a study on other gene variants, Cheyssac et al. [28] found that SNP rs941798 was associated with decreased HDL-C and increased triglyceride levels. Meanwhile, no associations were observed for cholesterol. Thus, they reported that PTP-1B variants may modify the lipid profile, thereby influencing susceptibility to the metabolic syndrome.

In contrast, Olivier et al. [11] examined six common sequence variants in the PTP-1B gene for association with obesity and altered lipid profile and found no association between plasma levels of TG and HDL-C and any of the six SNPs. Ali et al. [29] found that there were reductions in serum TG and FFAs following deletion of PTP-1B, combined with the marked increase in PTP-1B expression in adipose tissue and improvement in insulin receptor signaling in adipose tissue.


  Conclusion Top


The results obtained in this study agree with the theory that PTP-1B polymorphisms could be implicated in the pathogenesis of EHT. Moreover, PTP-1B SNP could be involved in the development of many characteristics of dyslipidemia and obesity in patients suffering from hypertension, thereby influencing susceptibility to the metabolic syndrome.


  Acknowledgements Top


Conflicts of interest

There are no conflicts of interest.

 
  References Top

1.
Qiao S, Ye Q, Dou Y, Li M, Kou Y, Qian D, et al. Analysis for hypertension and related risk factors of physical examination population. Int J Clin Exp Med 2013; 6 :785-793.  Back to cited text no. 1
    
2.
Oparil S, Zaman M, Calhoun D. Pathogenesis of hypertension. Ann Intern Med 2003; 139 :761-776.  Back to cited text no. 2
    
3.
Gu P, Jiang W, Du H, Shao J, LU B, Wang J, et al. Protein tyrosine phosphatase 1B gene polymorphisms and essential hypertension: a case-control study in Chinese population. J Endocrinol Invest 2010; 33 :483-488.  Back to cited text no. 3
    
4.
Zeng F, Ni E, Wang S, Lv S, Cao C, Zhang H, et al. A monoclonal antibody against the catalytic domain of PTP1B. Hybridoma (Larchmt) 2012; 31 :209-213.  Back to cited text no. 4
    
5.
David B, Burtis CA, Ashwood ER. Carbohydrate. In: Valerie L, editor. Tietz text book of clinical chemistry and molecular diagnostics. 6th ed. USA: Elsevier Press 2008;374-389.  Back to cited text no. 5
    
6.
Price CP, Jams DR. Analytical reviews in clinical biochemistry, the measurement of urate. Ann Clin Biochem 1988; 25 :484-498.  Back to cited text no. 6
    
7.
Jaffe M. Uber den niederschlag, welchen pikrinsaure in normalen hrn erzeugt und uber eine neue reaction des kreatinins. Z Physiol Chem 1886; 10 :391-400.  Back to cited text no. 7
    
8.
Rifai N, Bachori K, Alber S. Lipids lipoprotein and apolipoprotein. In: Burtis C, Ashwood E, Bruns D, editors. Tietz fundamental of clinical chemistry. 5th ed. USA: Elsevier 2001;484-489.  Back to cited text no. 8
    
9.
Jabbar J, Siddiqui I, Raza Q. Comparison of two methods (precipitation manual and fully automated enzymatic) for the analysis of HDL and LDL cholesterol. J Pak Med Assoc 2006; 56 :59-61.  Back to cited text no. 9
    
10.
Friedwald WT, Levy RI, Fredrickson DS. Estimation of the concentration of low-density lipoprotein cholesterol in plasma without use of the preparative ultracentrifuge. Clin Chem 1972; 18 :499-502.  Back to cited text no. 10
    
11.
Olivier M, Hsiung C, Chuang L, Ho L, Ting C, Bustos V, et al. Single nucleotide polymorphisms in protein tyrosine phosphatase 1??? (PTPN1) are associated with essential hypertension and obesity. Hum Mol Genet 2004; 13 :1885-1892.  Back to cited text no. 11
    
12.
Hilal Y, Acar T, Koksal E, Gezmen K, Akbulut G, Bilici S, et al. The association of anthropometric measurements and lipid profiles in Turkish hypertensive adults. Afr Health Sci 2011; 11 :407-413.  Back to cited text no. 12
    
13.
Akande T, Adeleye J, Kadiri S. Insulin resistance in Nigerians with essential hypertension. Afr Health Sci 2013; 13 :655-660.  Back to cited text no. 13
    
14.
Saha M, Sana N, Shaha R. Serum lipid profile of hypertensive patients in the Northern Region of Bangladesh. J Bio Sci 2006; 14 :93-98.  Back to cited text no. 14
    
15.
Idemudia JO, Ugwuja EI. Plasma lipid profiles in hypertensive Nigerians. Internet J Cardiovasc Res 2008; 6 :82-87.  Back to cited text no. 15
    
16.
Xu C, Yang X, Zu S, Han S, Zhang Z, Zhu G. Association between serum lipids, blood pressure, and simple anthropometric measures in an adult Chinese population. Arch Med Res 2008; 39 :610-617.  Back to cited text no. 16
    
17.
Asaolu MF, Asaolu SS, Fakunle JB, Ogunleye ZA. Evaluation of lipid status of hypertensive Nigerians. Der Pharmacia Lettre 2010; 2 :6-9.  Back to cited text no. 17
    
18.
Osuji C, Omejua E, Onwubuya E, Ahaneku G. Serum lipid profile of newly diagnosed hypertensive patients in Nnewi, South-East Nigeria. Int J Hypertens 2012; 12 :1-7.  Back to cited text no. 18
    
19.
Pooja B, Mittal Y, Mathur A. Evaluation of lipid profile of North Indian hypertensive subjects. AJBPS 2013; 3 :38-41.  Back to cited text no. 19
    
20.
Lepira F, Kabangu J, Kayembe K, Nseka M. Correlates of serum lipids and lipoprotein in Congolese patients with arterial hypertension. Cardiovas J S Arf 2005; 16 :249-255.  Back to cited text no. 20
    
21.
Akintunde A. Epidemiology of conventional cardiovascular risk factors among hypertensive subjects with normal and impaired fasting glucose. S Afr Med J 2010; 100 :594-597.  Back to cited text no. 21
    
22.
Tunon J, Martín J, Blanco L, Tarín N, Egido J. Common pathways of hypercholesterolemia and hypertension leading to atherothrombosis: the need for a global approach in the management of cardiovascular risk factors. Vasc Health Risk Manag 2007; 3 :521-526.  Back to cited text no. 22
    
23.
Di Paola R, Frittitta L, Miscio G, Bozzali M, Baratta R, Centra M, et al. A variation in 3¢ UTR of hPTP1B increases specific gene expression and associates with insulin resistance. Am J Hum Genet 2002; 70 :806-812.  Back to cited text no. 23
    
24.
Chantemèle E, Muta K, Mintz J, Tremblay M, Marrero M, Fulton D, et al. Protein tyrosine phosphatase 1B, a major regulator of leptin-mediated control of cardiovascular function. Circulation 2009; 120 :753-763.  Back to cited text no. 24
    
25.
Spencer-Jones N, Wang X, Snieder H, Spector T, Carter N, O′Dell S. Protein Tyrosine Phosphatase-1B Gene PTPN1, selection of tagging single nucleotide polymorphisms and association with body fat, insulin sensitivity, and the metabolic syndrome in a normal female population. Diabetes 2005; 54 :3296-3304.  Back to cited text no. 25
    
26.
Mok A, Cao H, Zinman B, Hanley A, Harris S, Kennedy B, et al. A single nucleotide polymorphism in protein tyrosine phosphatase PTP-1B is associated with protection from diabetes or impaired glucose tolerance in Oji-Cree. J Clin Endocrinol Metab 2002; 87 :724-727.  Back to cited text no. 26
    
27.
Echwald S, Bach H, Vestergaard H, Richelsen B, Kristensen K, Drivsholm T, et al. A P387L variant in protein tyrosine phosphatase-1B (PTP-1B) is associated with type 2 diabetes and impaired serine phosphorylation of PTP-1B in vitro. Diabetes 2002; 51 :1-6.  Back to cited text no. 27
    
28.
Cheyssac C, Lecoeur C, Dechaume A, Bibi A, Charpentier G, Balkau B, et al. Analysis of common PTPN1 gene variants in type 2 diabetes, obesity and associated phenotypes in the French population. BMC Med Genet 2006; 7 :44.  Back to cited text no. 28
    
29.
Ali M, Ketsawatsomkron P, Belin de Chantemele E, Mintz JD, Muta K, Salet C, et al. Deletion of protein tyrosine phosphatase 1b improves peripheral insulin resistance and vascular function in obese, leptin-resistant mice via reduced oxidant tone. Circ Res 2009; 105 :1013-1022.  Back to cited text no. 29
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Aim of the work
Participants and...
Results
Discussion
Conclusion
Acknowledgements
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed612    
    Printed9    
    Emailed0    
    PDF Downloaded56    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]