Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2013  |  Volume : 26  |  Issue : 1  |  Page : 1-6

PASD1 gene expression in acute myeloid leukemia patients


1 Department of Internal Medicine, Faculty of Medicine, Menoufia University, Menufia, Egypt
2 Department of Clinical Pathology, Faculty of Medicine, Menoufia University, Menufia, Egypt
3 Department of Department of Clinical Hematology, Faculty of Medicine, Ain Shams University, Cairo, Egypt

Date of Submission28-Feb-2013
Date of Acceptance09-Apr-2013
Date of Web Publication26-Jun-2014

Correspondence Address:
Mohamed A. Abd El Hafez
MSc, Hematology Unit, Department of Internal Medicine, Faculty of Medicine, Menoufia University, Menufia
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.7123/01.MMJ.0000429685.72655.d8

Rights and Permissions
  Abstract 

Objective

To detect the expression of the PASD1 gene in acute myeloid leukemia (AML) patients and its relation to clinical features and complete remission of AML.

Background

AML is a heterogeneous disease with variable clinical outcomes. PASD1 [Per ARNT Sim (PAS) Domain containing protein 1] can stimulate autologous T-cell responses, and it is therefore considered to be a potential immunotherapeutic target for the treatment of various malignancies, including AML.

Materials and methods

The study was carried out on 60 AML patients (group I) and 30 healthy controls (group II). Reverse transcriptase PCR analysis of the PASD1 gene was carried out for all patients and controls.

Results

PASD1 was expressed in 12 (20%) AML patients, but was not expressed in any of the 30 controls. PASD1 expression was associated more with patients below 45 years (66.7% of the PASD1-positive patients were <45 years old compared with 29.2% of the PASD1-negative patients). No significant correlation was found between PASD1 gene positivity and any of the clinical and hematological variables of AML, except for less incidence of fever at presentation. PASD1-positive patients achieved more complete remission (66.7%) compared with PASD1-negative patients (35.4%) (P<0.05).

Conclusion

PASD1 is an attractive leukemia-associated antigen. Its expression was associated with young age and favorable outcome. However, further studies are required, with standardization of the age, clinical, and cytogenetic and molecular genetic prognostic markers, to confirm the prognostic value of PASD1 gene expression in AML, to assess its correlation with clinical features of AML patients, and to investigate its role in minimal residual disease detection and immunotherapy of AML.

Keywords: acute myeloid leukemia, cancer-testis antigens genes, PASD1


How to cite this article:
Baghdady IM, Glal AZ, Shoeab SA, Ahmed TM, Essa ES, Ragheb A, Abd El Hafez MA. PASD1 gene expression in acute myeloid leukemia patients. Menoufia Med J 2013;26:1-6

How to cite this URL:
Baghdady IM, Glal AZ, Shoeab SA, Ahmed TM, Essa ES, Ragheb A, Abd El Hafez MA. PASD1 gene expression in acute myeloid leukemia patients. Menoufia Med J [serial online] 2013 [cited 2020 Feb 17];26:1-6. Available from: http://www.mmj.eg.net/text.asp?2013/26/1/1/135420


  Introduction Top


Acute myeloid leukemia (AML) is a heterogeneous disease with variable clinical outcomes. Cytogenetic analysis indicates which patients may have favorable risk disease, but the 5-year survival in this category is only ∼60%, with intermediate-risk and poor-risk groups faring far worse. Advances in understanding of the biology of leukemia pathogenesis and prognosis have not been matched with clinical improvements. Unsatisfactory outcomes persist for the majority of patients with AML, particularly the elderly. Novel agents and treatment approaches are required 1.

The success of any antigen-specific immunotherapeutic strategy depends critically on the choice of target antigen. Ideal molecules for immune targeting in AML are those that are (a) leukemia-specific; (b) expressed in most leukemic blasts including leukemic stem cells; (c) important for the leukemic phenotype; (d) immunogenic; and (e) clinically effective (show clinical utility) 2.

Cancer-testis antigens (CTAs), encoded by CT genes, are a group of testicular-specific or testicular-predominant proteins that are aberrantly expressed on tumor cells. CTAs are potentially suitable molecules for tumor vaccines of hematological malignancies because of their high immunogenicity in vivo 3. PASD1 [Per ARNT Sim (PAS) Domain containing protein 1] is a member of the CT-X group of CTAs. The PASD1 gene maps to the q28 region of chromosome X. The PASD1-predicted protein is suggested to encode a transcription factor. PASD1 can stimulate autologous T-cell responses, and it is therefore considered to be a potential immunotherapeutic target for the treatment of various malignancies, including diffuse large B-cell lymphoma and AML 4.

To our knowledge, the PASD1 gene was investigated in AML by Guinn et al. 5 and Brooks et al. 6 and diffuse large B-cell lymphoma by Liggins et al. 7, and Tahar et al. 8, and in multiple myeloma by Sahota et al. 9.

The objective of the present study is to detect the expression of the PASD1 gene in AML patients and its relation to clinical features and achievement of complete remission (CR) in these patients.


  Materials and methods Top


The study was carried out on 60 AML patients and 30 healthy controls matched for age and sex. All patients were selected from the inpatients and outpatients of the Internal Medicine department of Menoufia University hospitals and Ain Shams Hematology Unit during the period from February 2011 to July 2012. The studied population was divided into two groups: group I included 60 AML patients diagnosed by blood film and bone marrow examination, immunophenotyping, and cytogenetics study by G-banding on bone marrow samples. Patients were 25 men and 35 women; their ages ranged between 18 and 75 years, median 48.1±18.0 years. Group II included 30 apparently healthy age-matched and sex-matched control individuals. They were 14 men and 16 women, ranging between 18 and 75 years of age, median 45.0±17.6 years.

The procedures followed are in accordance with the ethical standards of the responsible institutional committee on human experimentation and with the Helsinki Declaration of 1975, as revised in 1983.

Sampling

From all participants, 2–3 ml peripheral blood on EDTA samples was obtained and stored as a cell pellet on lysate at −80°C for RNA extraction and subsequent detection of PASD1 gene expression by reverse transcriptase PCR (RT-PCR).

Methods

RNA extraction was performed using the QIAamp RNA Blood Mini Kit (Catalogue no. 52304; QIAGEN, Hilden, Germany). DNAase treatment was performed and checked on an agarose-TBE gel. Its concentration (ng/μl)and purity were measured spectrophotometrically.

The GeneAmp® Gold RNA PCR Reagent Kit (Applied Biosystems, Foster City, California, USA) was used for the RT-PCR amplification. First-strand cDNA was synthesized from 1 µg RNA in a 20 µl reaction mix containing 1× RT-PCR buffer, 25 mmol/l MgCl2, 10 mmol/l dNTP blend, 0.5 μl RNase inhibitor 10 U/20 μl, 100 mmol/l DTT, 0.5 μl (1.25 μmol/l) random hexamers, and 0.3 μl MultiScribe Reverse Transcriptase (50 U/μl) in RNase-free water. Cycling parameters for the RT included hybridization for 10 min at 25°C and reverse transcription for 45 min at 42°C.

To check the integrity of the cDNA, the housekeeping gene β-actin was amplified as a control gene using the following primer pair.

Forward primer: 5′GGCATCGTGATGGACTCCG3′.

Reverse primer: 5′GCTGGAAGGTGGACAGCGA3′.

PCR cycling conditions were as follows: 5 min at 95°C, followed by 26 cycles of 1 min at 95°C, 1 min at 60°C, and 2 min at 72°C, followed by a final elongation of 10 min at 72°C.

Detection of PASD1 gene expression

A volume of 2.5 µl of cDNA was added to a final PCR reaction mixture of 25 µl containing; 4.7 µl of 5× RT-PCR buffer, 1.75 mmol/l MgCl, 0.8 mmol/l dNTP (200 μmol/l of each dNTP), 1.25 U AmpliTaq Gold DNA polymerase, and 1 µmol/l of each PASD1-specific primers.

PASD1 (forward primer): 5′AGCCACCTCTGTGCTGACTT3′.

PASD1 (reverse primer): 5′GGTTCAACGTACACGGCTTT3′.

The reaction mixture was subjected to an initial step of denaturation at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 1 min, annealing at 58°C for 1 min, and extension at 72°C for 1 min, followed by a terminal step of extension at 72°C for 5.0 min.

The PCR products were resolved on an ethidium bromide-stained 2.0% agarose gel and UV photographed [Figure 1].
Figure 1: Agarose gel electrophoresis of the PASD1 gene. Lane 1, molecular weight marker; lane 2, PASD1 gene-positive sample; lanes 3–11, PASD1 gene-negative samples; lane 12, nontemplate control. PASD1, Per ARNT Sim (PAS) Domain containing protein 1.

Click here to view


Statistical analysis

Results were collected, tabulated, and statistically analyzed using an IBM personal computer and statistical package SPSS version 16 (SPSS Inc., Chicago, Illinois, USA).


  Results Top


The study was carried out on 60 AML patients and 30 apparently healthy age-matched and sex-matched control individuals. PASD1 was expressed in 12 (20%) AML patients (group I) but not in any of the 30 healthy controls (group II). The expression of PASD1 in AML patients was statistically higher compared with the controls (P<0.05) [Table 1].
Table 1: Distribution of PASD1 among the groups studied

Click here to view


In the PASD1-positive AML patients, eight patients (66.7%) were below 45 years and four patients (33.3%) were at least 45 years, but in the PASD1-negative AML patients 14 patients (29.2%) were below 45 years and 34 patients (70.8%) were at least 45 years. In terms of the distribution of the studied PASD1 among AML patients according to age, there was a significant difference (P<0.05). In the distribution of the studied PASD1 among AML patients according to sex, there was no significant difference (P>0.05) [Table 2].
Table 2: Distribution of the studied PASD1 results among AML patients in terms of their age and sex

Click here to view


There was no significant relation between PASD1 expression and any of the clinical (splenomegaly, hepatomegaly bleeding tendency, and lymphadenopathy) and hematological variables [Hb, platelet count, white blood cell (WBC) count, prothrombin time (PT), international normalized ratio (INR), partial prothrombin time, fibrinogen level, and fibrin degradation products], except a low incidence of fever in PASD1-positive AML patients at presentation. In the PASD1-positive AML patients, three patients (25%) had fever and nine patients (75%) did not have fever. In the PASD1-negative AML patients, 29 patients (60.4%) had fever and 19 (39.6%) did not have fever. In terms of the occurrence of fever in PASD1-positive and PASD1-negative patients, there was a significant difference (P<0.05) [Table 3].
Table 3: Distribution of the studied PASD1 results among patients in terms of their hematological variables and clinical features

Click here to view


In the PASD1-positive AML subgroup, 10 patients (83.3%) were CD13 positive, 11 patients (91.7%) were CD33 positive, four patients (33.3%) were CD34 positive, and seven patients (58.3%) were CD117 positive. In the PASD1-negative AML subgroup, 40 patients (81.3%) were CD13 positive, 41 patients (85.4%) were CD33 positive, 27 patients (56.3%) were CD34 positive, and 29 patients (60.4%) were CD117 positive. The expression of PASD1 was not related to the expression of CD13, CD33 (panmyeloid markers) and CD34, CD117 (stem cell markers) on AML blast cells (P>0.05).

In PASD1-positive AML patients, one patient (8.3%) was M0, two patients (16.7%) were M1, four patients (33.4%) were M2, one patient (8.3%) was M3, two patients (16.7%) were M4, and two patients (16.7%) were M5. PASD1 was not expressed in any of the two patients with AML in addition to chronic myeloid leukemia. The expression of the PASD1 gene is not related to any of the morphological subtypes of AML.

In PASD1-positive AML patients, nine patients (75%) had normal karyotyping and three (25%) had abnormal karyotyping. In PASD1-negative AML patients, 28 patients (58.3%) had normal karyotyping and 20 (41.7%) had abnormal karyotyping. The difference in the karyotyping between PASD1-positive and PASD1-negative patients was not significant (P>0.05). In PASD1-positive patients, three patients had abnormal karyotyping; two of them had inv16 and one had t(8,21). In PASD1-negative patients, 20 patients had abnormal karyotyping, five with t(8,21), five with t(15,17), four with inv16, and six with different cytogenetic abnormalities (11q23, −20, −14, −5, −7, and trisomy 21).

In our study, CR was achieved in 25 AML patients (41.7%). In PASD1-positive patients, eight (of 12) patients (66.7%) achieved CR. In the PASD1-negative subgroup, 17 (of 48) patients (35.4%) achieved CR. A statistically significant relation was found between CR and PASD1 gene expression (P<0.05). Thus, PASD1-positive AML patients showed greater CR [Table 4].
Table 4: Distribution of the studied PASD1 results among patients in the occurrence of complete remission

Click here to view


In our study, 15 patients (60%) of 25 patients who achieved CR were younger than 45 years of age and only seven patients (20%) of 35 patients who did not achieve CR were younger than 45 years of age. A statistically significant relation was found between CR and young age (<45 years) (P<0.05). No significant relation was found between CR and the splenomegaly, WBCs greater than 50×109 /l, and low fibrinogen level (P>0.05) [Table 5].
Table 5: Relation of important clinical and hematological variables with CR

Click here to view



  Discussion Top


In terms of the expression of the PASD1 gene, our study used RT-PCR for detection of the gene and found that PASD1 was expressed in 12 of 60 AML patients (20%) but PASD1 was not expressed in any of the controls. This level of expression of PASD1 in AML patients was less than that reported by Guinn et al. 5 by RT-PCR, which was 33% (four of 12), but PASD1 was not expressed in the controls as our study found. Moreover, Guinn et al. 5 immunoscreened for the PASD1 antigen (by SEREX technique=serological analysis of expression cDNA libraries) and found that the PASD1 sequence was recognized by 35% of AML sera but not recognized by normal donor sera.

In terms of the relation between PASD1 expression in AML patients and age, our study found that PASD1 was significantly expressed in patients below 45 years old (eight of 12=66.7%). The decision on the therapy depends significantly on the age of the patients and most guidelines use the age of 60 as a therapeutic divergence point, but we used the age of 45 years as most patients in our study older than 45 years had many comorbidities such as diabetes mellitus, ischemic heart disease, hepatitis C virus-related liver cirrhosis, and other comorbidities that affect the decision of therapy and limit the use of aggressive chemotherapy and stem cell transplantation as lines of treatment.

Our study found a significant relation between PASD1 expression and low incidence of fever at presentation, whereas no significant relation was found with bleeding tendency, splenomegaly, hepatomegaly, and lymphadenopathy. The occurrence of fever at presentation is significantly higher in PASD1-negative than in PASD1-positive patients. This can be attributed to the high percentage of patients (eight of 12, 66.7%) of younger age (<45 years old) among PASD1-positive AML patients whereas in PASD1-negative patients, 34 of 48 (70.8%) were older than 45 years of age, with the majority of them older than 60 years. It is well known that AML patients are immunocompromised and have an increased risk of infections. Elderly individuals also have an increased risk of infection. Elderly AML patients have double the risk of infection, which presents with fever. Thus, the younger age of patients with positive PASD1 may explain the lower incidence of fever in this group. The small number of studied patients may have played a role in this result. The relation of the immunological response against the PASD1 gene and the low incidence of fever at presentation of AML patients is not clear.

Our study found no significant relation between PASD1 expression and any of the hematological variables measured (Hb, platelet count, WBCs count, PT, INR, partial prothrombin time, fibrinogen level, and fibrin degradation products).

In terms of the relation between PASD1 expression and the AML morphological subtypes, our study found that all morphological subtypes included in the PASD1-positive subgroup were as follows: one patient (8.3%) was M0, two patients (16.7%) were M1, four patients (33.4%) were M2, one patient (8.3%) was M3, two patients (16.7%) were M4, and two patients (16.7%) were M5.The two patients who were AML in addition to chronic myeloid leukemia did not express the PASD1 gene. The expression of the PASD1 gene is not related to any of the morphological subtypes. This is in agreement with Guinn et al. 5, who did not find any relation between PASD1 expression and AML morphological subtypes.

In terms of the expression of CD117, our study found that 36 of 60 AML cases (60%) expressed CD117. This is in agreement with Hans et al. 10 and Auewarakul et al. 11, who found that 64 and 67% of AML cases expressed CD117 on leukemic blasts, respectively. In terms of the expression of CD34, our study found that 51.7% (31 of 60) AML cases expressed CD34. This was in agreement with Raspadori et al. 12 and Stagno et al. 13, who found that 51 and 52.9% AML cases express CD34, respectively. Ismail and Hosny 14 found that 61% of AML cases expressed CD34.

Although the frequency of CD34 expression in PASD1-positive AML patients is much less (only one-third of patients expressed and two-thirds did not express CD34) than that in PASD1-negative patients, the difference was insignificant. This may be because of the small number of patients in our study. CD34 is a stem cell marker; thus, our study may suggest low expression of the PASD1 gene in leukemic stem cells, which needs further confirmations.

In terms of the age of AML patients, patients below 45 years were significantly associated with a higher CR rate (15 of 25=60%) compared with patients at least 45 years who had a lower CR rate; this was in agreement with Creutzig et al. 15, who considered increasing age as an unfavorable prognostic factor for AML.

In terms of the relation between the presence of splenomegaly at presentation and CR, our study did not find a significant relation, although only 10 of 25 patients (40%) who achieved CR had splenomegaly. This is in contrast to Farag et al. 16, who found that splenomegaly could predict a lower CR rate, especially in young adults with normal karyotyping.

In our study, high leukocytic count (≥50×109 /l) was not significantly associated with a lower CR rate; three of 25 patients (12%) who achieved CR had WBCs of at least 50×109/l and nine of 35 patients (25.7%) did not achieve CR. This was not in agreement with Colovic et al. 17, who found that leukocytosis was associated with a lower CR rate and is considered one of the factors that affects the outcomes of primary resistant patients with AML.

In terms of the relation of low fibrinogen level and CR, our study did not find any significant relation, although the number of patients with low fibrinogen level who achieved CR was only six of 25 (24%). Schellongowski et al. 18, found that low fibrinogen level increased the risk of intensive care admission and was associated with lower CR.

Our study did not find any significant relation between PASD1 expression and cytogenetics. This was in agreement with Guinn et al. 5.

In terms of the response to treatment, our study found a significant relation between PASD1 expression and the CR rate, where the number of CR is more in PASD1-positive patients as eight of 12 patients (66.7%) achieved CR. The results of our study can be attributed to the fact that PASD1 had a tissue-restricted pattern, which is likely to be because of global promoter hypomethylation in tumor cells and in the testes 19. The testis is considered an immunoprivileged organ (because of the existence of the blood–testis barrier) 20 and testicular cells did not express major histocompatibility complex class I 21; thus, an aberrant expression of PASD1 on AML blasts and the high immunogenicity of PASD1 will stimulate immune response against it. It was found that PASD1 can stimulate humoral and cellular immune response (PASD1 can be recognized by CD8+ T cells) 8; thus, this aberrant expression of the PASD1 gene on AML blasts may aid tumor clearance by the immune system. One related finding to the good response to treatment in PASD1-positive patients is that most patients of this group (eight of 12) were younger than 45 years of age and younger patients have better outcome than older patients because of age-related factors. Another possibly related finding is the cytogenetics of the PASD1-positive patients, as two of them had inv16 and one had t(8,21), which are considered to carry a favorable prognosis. The remaining nine patients has normal karyotyping, which carries an intermediate prognosis, but we did not investigate other gene mutations with a favorable prognosis (e.g. NPM1, CEPBA). In addition, among PASD1-positive patients, no one has worse cytogenetics. Another finding is the lower number of patients associated with worse clinical and laboratory variables among PASD1-positive AML patients; only four of 12 patients (33.3%) had splenomegaly, only two of 12 patients (16.7%) had WBCs more than at least 50×109 /l, and only two of 12 patients (16.7%) had low fibrinogen level. Thus, although our study found that PASD1 expression was associated with a more CR rate, we cannot confirm the good prognostic value of PASD1 in the prognosis of AML as there were other factors that might have played a role in this favorable prognosis.


  Conclusion Top


PASD1 is an attractive leukemia-associated antigen. Its expression was associated with young age and favorable outcome. However, further studies are required, with standardization of the age, clinical, and cytogenetic and molecular genetic prognostic markers, to confirm the prognostic value of PASD1 gene expression in AML, to assess its correlation with clinical features of AML patients, and to investigate its role in minimal residual disease detection and immunotherapy of AML.[21]

 
  References Top

1.Lin TL, Yair Levy M.Acute myeloid leukemia: focus on novel therapeutic strategies.Clin Med Insights Oncol2012;6:205–217.  Back to cited text no. 1
    
2.Anguille S, Van Tendeloo VF, Berneman ZN.Leukemia-associated antigens and their relevance to the immunotherapy of acute myeloid leukemia.Leukemia2012;26:2186–2196.  Back to cited text no. 2
    
3.Lim SH, Zhang Y, Zhang J.Cancer-testis antigens: the current status on antigen regulation and potential clinical use.Am J Blood Res2012;2:29–35.  Back to cited text no. 3
    
4.Liggins AP, Lim SH, Soilleux EJ, Pulford K, Banham AH.A panel of cancer-testis genes exhibiting broad-spectrum expression in haematological malignancies [abstract].Cancer Immun2010;10:8.  Back to cited text no. 4
    
5.Guinn BA, Bland EA, Lodi U, Liggins AP, Tobal K, Petters S, et al..Humoral detection of leukaemia-associated antigens in presentation acute myeloid leukaemia.Biochem Biophys Res Commun2005;335:1293–1304.  Back to cited text no. 5
    
6.Brooks S, Bonney S, Smits E.Detection of tumour antigen specific T-cell populations in leukaemia: markers of good prognosis? 10th Annual Meeting in cancer immunotherapy (CIMT) programe; May 23–252012.Mainz, Germany:Rheingoldhalle Congress Center;162.  Back to cited text no. 6
    
7.Liggins AP, Brown PJ, Asker K, Pulford K, Banham AH.A novel diffuse large B-cell lymphoma-associated cancer testis antigen encoding a PAS domain protein.Br J Cancer2004;91:141–149.  Back to cited text no. 7
    
8.Ait Tahar K, Liggins AP, Collins GP, Campbell A, Barnardo M, Cabes M, et al..CD4-positive T-helper cell responses to the PASD1 protein in patients with diffuse large B-cell lymphoma.Haematologica2011;96:78–86.  Back to cited text no. 8
    
9.Sahota SS, Goonewardena CM, Cooper CDO, Liggins AP, Ait Tahar K, Zojer N, et al..PASD1 is a potential multiple myeloma-associated antigen.Blood2006;108:3953–3955.  Back to cited text no. 9
    
10.Hans CP, Finn WG, Singleton TP, Schnitzer B, Ross CW.Usefulness of anti-CD117 in the flow cytometric analysis of acute leukemia.Am J Clin Pathol2002;117:301–305.  Back to cited text no. 10
    
11.Auewarakul C, Lauhakirti D, Promsuwicha O, Munkhetvit C.C-kit receptor tyrosine kinase (CD117) expression and its positive predictive value for the diagnosis of Thai adult acute myeloid leukemia.Ann Hematol2006;85:108–112.  Back to cited text no. 11
    
12.Raspadori D, Lauria F, Ventura MA, Rondelli D, Visani G, De Vivo A, et al..Incidence and prognostic relevance of CD34 expression in acute myeloblastic leukemia: analysis of 141 cases.Leuk Res1997;21:603–607.  Back to cited text no. 12
    
13.Stagno F, Cacciola R, Fiumara P, Guglielmo P, Cacciola E.CD34 antigen expression in adult AML may have a prognostic significance [1996 meeting abstracts].Cancer Detect Prev1996;20  Back to cited text no. 13
    
14.Ismail MA, Hosny SM.Prognostic significance of progenitor cell markers in acute myeloid leukemia.Life Sci J2011;8:680–686.  Back to cited text no. 14
    
15.Creutzig U, Büchner T, Sauerland MC, Zimmermann M, Reinhardt D, Döhner H, et al..Significance of age in acute myeloid leukemia patients younger than 30 years: a common analysis of the pediatric trials AML-BFM 93/98 and the adult trials AMLCG 92/99 and AMLSG HD93/98A.Cancer2008;112:562–571.  Back to cited text no. 15
    
16.Farag SS, Ruppert AS, Mrózek K, Mayer RJ, Stone RM, Carroll AJ, et al..Outcome of induction and postremission therapy in younger adults with acute myeloid leukemia with normal karyotype: a cancer and leukemia group B study.J Clin Oncol2005;23:482–493.  Back to cited text no. 16
    
17.Colovic N, Tomin D, Vidovic A, Suvajdzic N, Jankovic G, Palibrk V, et al..Pretreatment prognostic factors for overall survival in primary resistant acute myeloid leukemia.Biomed Pharmacother2012;66:578–582.  Back to cited text no. 17
    
18.Schellongowski P, Staudinger T, Kundi M, Laczika K, Locker GJ, Bojic A, et al..Prognostic factors for intensive care unit admission, intensive care outcome, and post-intensive care survival in patients with de novo acute myeloid leukemia: a single center experience.Haematologica2011;96:231–237.  Back to cited text no. 18
    
19.Modarressi MH, Fard SGModarressi MH, Fard SG.Potential of cancer-testis antigens as targets for cancer immunotherapy.Bridging cell biology and genetics to the cancer clinic2011.Kerala, India83–98.  Back to cited text no. 19
    
20.Hofmann O, Caballero OL, Stevenson BJ, Chen YT, Cohen T, Chua R, et al..Genome-wide analysis of cancer/testis gene expression.Proc Natl Acad Sci USA2008;105:20422–20427.  Back to cited text no. 20
    
21.Jungbluth AA, Ely S, DiLiberto M, Niesvizky R, Williamson B, Frosina D, et al..The cancer-testis antigens CT7 (MAGE-C1) and MAGE-A3/6 are commonly expressed in multiple myeloma and correlate with plasma-cell proliferation.Blood2005;106:167–174.  Back to cited text no. 21
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials and me...
Results
Discussion
Conclusion
Introduction
Materials and me...
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed740    
    Printed9    
    Emailed0    
    PDF Downloaded122    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]